• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    Specific tlr-4 aptamers and uses thereof. The invention relates to a nucleic acid aptamer capable of specifically binding and inhibiting tlr-4, a complex comprising said aptamer and a functional group, as well as pharmaceutical compositions thereof. The invention also relates to uses and methods for detecting tlr-4 and to uses and methods for inhibiting tlr-4. Finally, the invention also relates to an aptamer for use in the manufacture of a medicament for the treatment of a pathology characterized by an increase in tlr4 expression and/or an increase in tlr-4 activation. (Machine-translation by Google Translate, not legally binding)
    公开号:ES2555160A1
    申请号:ES201430955
    申请日:2014-06-24
    公开日:2015-12-29
    发明作者:Ignacio LIZASOAIN HERNÁNDEZ；Víctor Manuel González Muñoz；Gerónimo Fernández Gómez-Chacón；María Ángeles MORO SÁNCHEZ；María Elena Martín Palma；Ana MORAGA YÉBENES
    申请人:Aptus Biotech S L；Aptus Biotech SL；
    IPC主号:
    专利说明:

    TLR-4 SPECIFIC APTAMERS AND USES OF THE SAME
    5 FIELD OF THE INVENTION
    The present invention provides nucleic acid aptamers capable of specifically binding and inhibiting TLR-4 and uses thereof.
    10 BACKGROUND OF THE INVENTION
    Currently, it is known that the Central Nervous System (CNS) responds, both to bacterial infections and brain damage, with a very well organized innate immune reaction. The innate immune system has the ability to recognize patterns
    15 highly conserved molecules, among others, of membrane receptors of the "toll-like" family (in English Toll-like receptors: TLR).
    TLR4 was the first TLR characterized in mammals. Exogenous ligands have been described for this TLR, such as lipopolysaccharide (LPS) from gram-negative bacteria, acid
    20 lipoteicoic (in English, lipoteichoic acid, L TA) of gram-positive bacteria or protein F of respiratory syncytial virus. In addition, the most important endogenous ligands are HMBG1, HSP-60, of endogenous origin or derived from Chlamydia pneumoniae, HPS-70, fibronectin, fibrinogen, hyaluronic acid, etc., all derived from tissue, cellular and / or The glasses of the host. TLR4 is involved in a large number of pathologies of high prevalence,
    25 such as stroke or cerebrovascular disease, acute myocardial infarction, sepsis, atherosclerosis, multiple sclerosis and rheumatoid arthritis among others.
    The involvement of innate immunity and, in particular, of TLRs in multiple pathologies, has led to a growing interest in the development of agonists and antagonists of these
    30 receivers Thus, agonists have been developed for the possible treatment of cancer, allergic diseases, infections and as vaccine adjuvants. On the other hand, TLR antagonists are being studied in sepsis, atherosclerosis, chronic pain and colitis; in fact there are several antagonists, eritoran (phase 111), ibudilast (Av411; phase 11), NI-0101 antibodies (preclinical phase) that are being studied in these pathologies.
    P201 430955
    WO 2006/138681 describes a method to inhibit the
    intrahepatic deletion of activated T cells by administration of a TLR-4 inhibitor, among which specific aptamers for TLR-4 are mentioned.
    5 Roger et al. (Roger et al., 2009, Proc Natl Acad Sci USA 106: 2348-52) describeantibodies specific for the extracellular domain of TLR4. These antibodies conferprotection against lethal sepsis of Gram negative bacteria in mice. I also knowsuggests the therapeutic utility of these anti-TLR-4 antibodies, since the treatment iseffective when antibodies are administered up to 4 h after exposure to
    10 endotoxin and up to 13 h after the onset of Escherichia coli infection.
    Therefore, there is a need in the art for new molecules capable of specifically binding and inhibiting TLR-4 and being useful as therapeutic agents.
    15 BRIEF DESCRIPTION OF THE INVENTION
    In a first aspect, the present invention relates to a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4, and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEO ID NO: 2 or a variant
    20 functionally equivalent thereof.
    In another aspect, the present invention relates to a complex comprising the aptamer of the invention and a functional group.
    In another aspect, the present invention relates to the use of the aptamer of the invention or of the complex of the invention to detect TLR-4.
    In another aspect, the present invention relates to the use in v of the aptamer of the invention.
    or of the complex of the invention to inhibit TLR-4.
    In another aspect, the present invention relates to an in vitro method for the detection of
    TLR-4 in a sample comprising i) contacting said sample with an aptamer according to the invention, or a complex according to the invention, ii) separating the apt or complex not bound to TLR-4, and

    iii) detect the presence of the aptamer or complex bound to the TLR-4 present in the
    sample.
    In vitro method for inhibiting TLR-4 in a sample comprising contacting a
    5 shows comprising TLR-4 with an aptamer according to the invention, or a complex according to the
    invention, under suitable conditions inhibit TLR4.
    An aptamer of the invention for use in the manufacture of a medicament for the
    treatment of a pathology characterized by an increase in TLR4 expression and / or a
    10 increased TLR-4 activation.
    A pharmaceutical composition comprising at least one aptamer according to the invention or
    at least one complex according to the invention, optionally in combination with one or more
    pharmaceutically acceptable carriers, excipients or solvents. 15 BRIEF DESCRIPTION OF THE FIGURES
    Figure 1. Recognition of TLR-4 protein by aptamers selected by ELONA. Recombinant human TLR-4 protein (6xHIS-TLR-4) was plated at a concentration of 100 ng / well in 96-well microtiter plates and incubated at 4 ° C for 16 h. Subsequently, 20 pmoles of each of the digoxigenin-labeled aptamers were added to each well and the plate was incubated for 1 h at 3rC. Finally, the plate was incubated with peroxidase-conjugated anti-digoxigenin antibodies and revealed using ABTS. A DNA aptamer against Li was used as a positive control
    25 H2A (Martin et al., 2013, PLoS ONE 8: e78886). All experiments were performed in triplicate.
    Figure 2. Secondary structures of the TLRApt # 1 R aptamers (SEa ID NO: 3), and TLRApt # 4F (SEO ID NO: 4) predicted using the mFold program. Boxes 30 show guanines that could be part of predicted G-quadruplex structures with the OGRS Mapper program.
    Figure 3. Union of 105 TLRApt # 1 R aptomers (SEO ID NO: 3), and TLRApt # 4F (SEO ID NO: 4) to recombinant hTLR-4 (A) and TLR-4 protein expressed in cells (B) . All 35 experiments were done in triplicate.

    Figure 4. Antagonist activity of TLRApt # 1 R aptamers (SEO ID NO: 3), and TLRApt # 4F (SEQ ID NO: 4) on HEK-Blue hTLR4 .. cells and the LPS-RS-UP antagonist (2 ng / ~ l; 20 ng) as controls, and the aptamers were applied at a concentration of 20 nM (A) or at final concentrations of 0.2, 2, 20 and 200 nM (B) or the control antagonist LPS-RS-UP (2 ng / ~ l; 20 ng). As a control, the LPS-EK-UP agonist (0.02 ng / ~ I) was used. All experiments were done in triplicate. Statistical significance ("P <0.05, .... P <0.01 and ...... P <O.001).
    Figure 5. Secondary structures of the TLRApt # 1 R-T aptamers (SEO ID NO: 1), and TLRApt # 4F-T (SEQ ID NO: 2) predicted using the mFold program. The boxes show the guanines that could be part of G-quadruplex structures predicted with the OGRS Mapper program.
    Figure 6. Effect of intraperitoneal injection of TLRApt # 1 R and TLRApt # 4F aptamers in reducing the infarcted area in experimental animals. Adult male mice C57BU10ScSn (WT; normal) and C57BL / 10ScNJ (KO, lacking functional TLR4), underwent induction of cerebral focal ischemia by means of occlusion of the middle cerebral artery with ligation. The mice were anesthetized with isoflurane and 24 hours after MeAD, the size of the infarction has been evaluated by MRI. The images highlighted in T2 (T2WI) have been acquired in a BIOSPEC BMT 47/40 operating at 4.7 T (BrukerMedical, Ettlingen, Germany; MRI Unit, Multidisciplinary Institute, UCM) and the damaged area is quantified by Image J 1.41 (NIH, Bethesda, Washington). Statistical significance ('P <O.05).
    Detailed description of the invention
    The authors of the present invention have selected and characterized two molecules that, due to their sequences, are capable of structuring three-dimensionally under certain conditions of pH, temperature and salt concentrations, which gives them the ability to specifically recognize the TLR-4 protein and modulate its activity. These molecules can inhibit the cellular response mediated by the TLR-4 receptor in vivo and are capable of reducing the size of the infarction in experimental animals, which gives them a potential therapeutic role.
    TLR-4 specific aptamer

    In a first aspect, the present invention relates to a nucleic acid aptamer with
    ability to specifically bind and inhibit TLR-4, hereinafter referred to as the "aptamer of the invention", and which comprises a sequence selected from the group consisting of SEO ID NO: 1 (CCGGCACGGGACAAGGCGCGGGACGGCGTAGATCAGGTC GACACC) and SEO ID NO: 2 ( GGTGTGCCAATAAACCATATCGCCGCGTIAGCATGTACTCG GTTGGCCCTAAATACGAG) or a functionally equivalent variant thereof.
    The term "aptamer", in the context of the present invention, refers to single stranded nucleic acid chains that adopt a specific tertiary structure that allows them to bind molecular targets with high specificity and affinity, comparable to that of monoclonal antibodies, a through interactions other than the classic Watson-Crick base pairing.
    The term "nucleic acid", in the context of the present invention, refers to any type of nucleic acid, such as AON and RNA, and variants thereof, such as peptidonucleic acid (APN, or in English "peptide nucleic acid "or PNA), the blocked nucleic acid (ANB, or in English" Iocked nuc / eic acid "or LNA), as well as combinations thereof, modifications thereof, including modified nucleotides, etc. The terms "nucleic acid" and "oligonucleotide" and "polynucleotide" are used interchangeably in the
    context of the present invention. Nucleic acids can be purified from natural sources, produced using recombinant expression systems and, optionally, purified, chemically synthesized, etc. When appropriate, for example, in the case of chemically synthesized molecules, nucleic acids may comprise nucleoside analogs such as analogs having chemically modified bases or sugars, skeleton modifications, etc. A nucleic acid sequence is represented in the 5'-3 'direction unless otherwise indicated.
    The term "TLR-4", in the context of the present invention, refers to the membrane receptor of the "toll-like" family 4. The TLR-4 receptor can also be referred to as ARM010, C0284, TLR4 or hTOLL. In humans, the TLR-4 receptor is collected under the access number in GenBank 000206.2 as of May 27, 2014, and which is encoded by the TLR4 gene. It consists of 839 amino acids, of which residues 1-23 constitute
    the signal sequence, residues 24-631 constitute the extracellular domain, residues 632-652 constitute the transmembrane domain and residues 653-839 constitute the cytoplasmic domain.
    P201 430955
    In a particular embodiment, the aptamer has the ability to specifically bind to the extracellular domain of TLR-4 (amino acids 24-631).
    The present invention contemplates an aptamer comprising a sequence selected from the group consisting of SEQ ID NO: 1 (CCGGCACGGGACAAGGCGCGGGACGGCGTA GATCAGGTCGACACC) and SECTION: 2 (GGTGTGCCAATAAACCATATCGCCGCGTTAGC
    ATGTACTCGGTTGGCCCTAAATACGAG) or a functionally equivalent variant thereof.
    The present invention also contemplates aptamers of the invention that are composed of nucleic acids such as DNA and RNA, as well as variants and nucleic acid analogs and combinations thereof, modifications thereof, including, without limitation, nucleic acid skeletons modified, substitution links, modified nucleotides, and ribose or deoxyribose analogs, modified nucleotides, etc. with a capacity to specifically bind and inhibit TLR-4 of at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at minus 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% of the ability to specifically bind and inhibit TLR-4 of the SEO sequence aptamer NO: 1 or SEO ID NO: 2. Non-limiting examples of variants and analogues Nucleic acids include, without limitation, APN, ANB and ATN.
    The term "variant of a nucleic acid" or "analog of a nucleic acid", in the context of the present invention, refers to variants and analogs of nucleic acids that include, without limitation, modified nucleic acid skeletons, substitution bonds , modified nucleotides, and ribose or deoxyribose analogs. For example, variants of nucleic acids according to the present invention may comprise structures with synthetic skeletons analogous to the typical phosphodiester backbone. These include, without limitation, phosphorothioate, phosphorodithioate, methylphosphonate, phosphoramidate, alkyl phosphotriester, sulfamate, 3'-thioacetal, methylene (methylimino), 3'-N-carbamate, morpholino carbamate and peptide nucleic acids (PNA), methylphosphonate bonds or alternating methylphosphonate and phosphodiester and benzylphosphonate.
    Variants of a nucleic acid may also contain one or more "substitution" bonds, as generally understood in the art. Some of these substitution links are nonpolar and contribute to providing the aptamer with an ability to

    spread across membranes. These "substitution" links are defined herein as conventional alternative bonds such as phosphorothioate or phosphoramidate, and are synthesized as described in commonly available literature. Alternative binding groups include, but are not limited to, embodiments in which a remainder of formula P (O) S, ("Iioalo"), P (S) S ("dilioalo"), P (O) NR '"P (O) R ', P (O) OR', CO, or CONR '"wherein R' is H (or a salt) or an alkyl group of 1-12 C atoms and R6 is an alkyl group of 1- 9 C atoms, which bind to adjacent nucleotides through -So of -0-. Dithioate bonds are described in US application 248517. The present invention also contemplates the use of substitution links that include non-phosphorus-based intermucleotidic bonds such as 3'-thioformacetal, (-S-CH2-O-), formacetal (-O -CH2-O-) and 3'amine internucleotide bonds (-NH-CH2-CH: d described in applications US 690786 and US 763130. One or more substitution links may be used in the aptamers of the invention for the purpose of further facilitate binding to TLR-4 or to increase the stability of aptamers against nucleases, as well as to confer permeation capacity.Not all the bonds within the same aptamer have to be identical and, therefore, the present invention contemplates aptamers with all identical links as well as aptamers with a variation in the composition of their links.
    Likewise, the nucleic acid variants according to the present invention may also contain analogous forms of ribose or deoxyribose that are well known in the art, including without limitation 2 'substituted sugars such as 2'-O-methyl-ribose, 2'-fluoribose or 2'-azido-ribose, carbocyclic analogs of sugars, a-anomeric sugars, epimeric sugars such as arabinose, xyloses or lixoses, pyranose sugars, furanose sugars and sedoheptulose sugars. Nucleic acids may also contain threose nucleic acid (ANT, or in English "threose nucleic acid" or TNA, also referred to as alpha-treofuranosyl oligonucleotides) (See, for example, Schong et al., Science 2000 November 17, 290 ( 5495): 1347-1351). In particular, the substitution at the 2 'position of the furanose residue is particularly important with respect to the improvement of nuclease stability.
    The term "nucleotide", in the context of the present invention, refers to the monomers that make up the nucleic acids. The nucleotides are formed by a pentose, a nitrogen base and a phosphate group, and are linked by phosphodiester bonds. The nucleotides that are part of DNA and RNA differ in the pentose, I feel this deoxyribose and ribose respectively. The nitrogen bases, in turn, are divided into purine nitrogen bases, which are adenine (A) and guanine (G), and into bases
    P201 430955
    Pyrimidine nitrogen, which are thymine (T), cytosine (C) and uracil (U). Thymine only appears in the AON, while the uracil only in the RNA. The present invention contemplates the use of modified nucleotides in the aptamer of the invention. The term "modified nucleotide." in the context of the present invention, it refers to known analogs of natural nucleotides, with similar or improved binding properties. Analogous forms of purines and pyrimidines are well known in the art, and include, without limitation, aziridinylcytosine, 4-acetylcytosine, 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, inosine, isopentenyladenyladenine, isopentenyladenyladenine, isopentenyladenyladenine, isopentenyldenyl , 1-methylpseudouracil, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, Nsmethyladenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl -thiouracil, beta-D-mannosylkeosine, 5-methoxyuracil, 2-methylthio-N-6-isopentenyladenine, uraciI0-5-oxyacetic acid methyl ester, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2tiouracil , 4-thiouracil, 5-methyluracil, uraciI0-5-oxyacetic acid, and 2,6-diaminopurine. In addition to the above modified nucleotides, nucleotide residues lacking a purine or a pyrimidine may also be included in the present invention.
    In addition to the above variants, the nucleic acid variants included in the invention also include APN, ANB and 5'-5 'or 3'-3' chains. The term "peptidonucleic acid" or "APN" or "PNA", in the context of the present invention, refers to an oligonucleotide whose skeleton is composed of repeating units of N- (2-aminoethyl) glycine linked by peptide bonds, in where the different nitrogenous bases are linked to the main chain by a methylene bond (-CHT) and a carbonyl group (- (C = O)). The term "blocked nucleic acid" or "ANB" or "LNA", in the context of the present invention, refers to a modified RNA nucleotide whose ribose moiety is modified with an additional bond that connects oxygen in 2 'with carbon in 4 ', blocking ribose in the 3'-endo conformation. The term "chain 5'-5 '" or "chain 3'-3"', in the context of the present invention, refers to oligonucleotides in which the nucleotide of the 3 'or 5' ends, respectively, is inverted.
    As used in the present invention, the term "functionally equivalent variant" refers to aptamers with sequences substantially similar to SEO ID NO: 1 or SEO ID NO: 2 that maintain their ability to specifically bind and inhibit TLR-4. A functionally equivalent variant of the aptamer of the invention may be a nucleic acid sequence derived from SEO ID NO: 1 or SEO ID NO: 2 comprising the addition, substitution or modification of one or more nucleotides. As an illustration,
    P201 430955
    Functionally equivalent variants of the aptamer of the invention include sequences comprising the addition of 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 10 nucleotides, 15 nucleotides, 20 nucleotides, 25 nucleotides, 30 nucleotides, 35 nucleotides, 40 nucleotides , 45 nucleotides, 50 nucleotides, 60 nucleotides, 70 nucleotides, 80 nucleotides, 90 nucleotides, 100 nucleotides, 150 nucleotides, 200 nucleotides, at least 500 nucleotides, at least 1000 nucleotides or more at the 5 'end of the SEO ID NO sequence : 1 or SEO ID NO: 2 yfo comprising the addition of 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 10 nucleotides, 15 nucleotides, 20 nucleotides, 25 nucleotides, 30 nucleotides, 35 nucleotides, 40 nucleotides, 45 nucleotides, 50 nucleotides, 60 nucleotides, 70 nucleotides, 80 nucleotides, 90 nucleotides, 100 nucleotides, 150 nucleotides, 200 nucleotides, at least 500 nucleotides Tissues, at least 1000 nucleotides or more at the 3 'end of the SEO ID NO: 1 or SEO ID NO: 2 sequence, and which maintain an ability to specifically bind and inhibit TLR-4 of at least 50%, by minus 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% of your ability to join specifically and inhibit TLR-4.
    The present invention also includes aptamers comprising nucleotide sequences with a sequence identity of at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99 % with SEO ID NO: 1 or SEO ID NO: 2 sequences and that maintain a capacity to specifically bind and inhibit TLR-4 of at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95 %, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% of their ability to specifically bind and inhibit TLR-4.
    The term "identity", in the context of the present invention, refers to the overall similarity relationship between nucleic acid molecules, which is expressed in the form of a percent identity. The calculation of the percent identity of two sequences of Nucleic acids can be performed by aligning the two sequences for optimal comparison purposes, and it is a function of the number of identical positions shared by the sequences, taking into account the number of holes and the length of each hole, which must be introduced for the optimal alignment of the two sequences. The comparison of
    P201 430955
    sequences and the determination of the percentage of identity between two sequences can be carried out using a mathematical algorithm such as the one incorporated in the LALlGN program (Goujon el al., 2010, Nucleic Acids Res 38 (Web Server issue): W695-9).
    The term "specific binding ~ or" specific binding to TLR-4 ", in the context of the present invention, refers to the non-covalent physical association between two molecules, the aptamer of the invention and the TLR-4 receptor. between the aptamer of the invention and the TLR-4 receptor is considered specific if the strength of the bond between them is at least 10 times, at least 15 times, at least 20 times, at least 25 times, at least 50 times, at at least 75 times or at least 100 times greater than the strength of the bond between the aptamer of the invention and an irrelevant molecule.The binding between the aptamer of the invention and the TLR-4 receptor is also considered specific if the equilibrium constant of Kd dissociation is 10.3 M or less, 10-4 M or less, 10-5 M or less, 10.6 M or less, 10.7 M or less, 10-8
    11 12
    M or less, 10-9 M or less, 10. 10 M or less, 10-M or less, or 10. M or less under the conditions used, for example, in physiological conditions, cell culture conditions or conditions that allow cell survival.
    The aptamer's ability of the invention to specifically bind to TLR-4 can be determined by a variety of assays that are available in the art. Preferably, the TLR-4 specific binding capacity of the aptamer of the invention is determined by in vitro binding assays, such as the enzyme-linked oligonucleotide assay (in English "Enzyme-Linked OligoNucleotide Assay", ELONA), the assay. by absorption by enzyme-linked aptamer (in English "Enzyme-Linked Aptamer Sorbent Assay", ELASA), precipitation and quantitative PCR (qPCR), or by fluorescence techniques such as aptahistochemistry, aptacytochemistry, fluorescence microscopy or flow cytometry. Likewise, both the specific binding capacity to TLR-4 and the affinity of the aptamer for TLR-4 can be determined by techniques widely known to the person skilled in the art, such as the gel mobility change test. shift assay "), surface plasmon resonance (SPR), kinetic capillary electrophoresis and fluorescence binding assay. Briefly, the fluorescence binding assay consists of the incubation of TLR-4 coated magnetic balls with different concentrations (for example, from O to 100 nM) of the labeled aptamer of the invention (for example, with carboxyfluorescein, FAM), and the subsequent elution and detection of attached aptamers; dissociation constants (Kd) are calculated by nonlinear fit analysis.

    The term "inhibition of TLR-4", in the context of the present invention, refers to blocking or decreasing the activity of TLR-4, that is, signal transduction mediated by the TLR-4 receptor. TLR-4 activity is considered to be inhibited by an inhibitory or antagonistic agent when its activity is at least 95%, at least 90%, at least 85%, at least 80%, at least 75 %, at least 70%, at least 65%, at least 60%, at least 55%, at least 50%, at least 45%, at least 40%, at least 35%, at least 30%, at least 25%, at least 20%, at least 15%, at least 10%, at least 5%, at least 1%, or less of the TLR activity- 4 in the presence of its natural agonist LPS.
    The aptamer's ability of the invention to inhibit TLR-4 can be determined by a variety of assays that are available in the art. Preferably, the ability to inhibit TLR-4 from the aptamer of the invention is determined by in vitro assays with cells expressing recombinant TLR-4 and a reporter gene whose expression is associated with the activation of recombinant TLR-4. The person skilled in the art will recognize that there are multiple variants of this method, depending on the cell and the recombinant gene used. An example of this test is set out in the Examples of the present invention (section "Materials and methods" and Example 2). Other available techniques include the determination of inflammatory cytokine levels, such as IL-1, IL-8, TNF-alpha and IL-1 2, released by cells expressing TLR-4.
    In a particular embodiment, the aptamer of the invention consists of between 30 and 200 nucleotides, preferably between 35 and 150 nucleotides, more preferably between -40 and 100 nucleotides, even more preferably between 45 and 80 nucleotides.
    In another particular embodiment, the aptamer of the invention comprises a sequence selected from the group consisting of SEO ID NO: 3 (GTIGCTCGTATTTAGGGCCACCG GCACGGGACAAGGCGCGGGACGGCGTAGATCAGGTCGACACCAGTCTICATCCGC) and SEQ ID NO: 4 (GCGGATGAAGACTGGTGTGCCAATAAACCATATCGCCGCGTIAGCATGT ACTCGGTIGGCCCTAAATACGAGCAAC). The SEO ID NO: 3 sequence is a functionally equivalent variant of SEa ID NO: 1 and the sequence SEa ID NO: 4 is a functionally equivalent variant of SEa ID NO: 2.
    In a particular embodiment, the nucleic acid is AON. In another particular embodiment, the nucleic acid is RNA. In another particular embodiment, the nucleic acid is APN. In other

    particular embodiment, the nucleic acid is ANB. In another particular embodiment, the nucleic acid is ATN.
    In another particular embodiment, the TLR-4 is a TLR-4 selected from the group consisting of mouse, rat, rabbit, pig, cat, dog, horse, primate, and human. In a preferred embodiment, the TLR-4 is a human TLR-4.
    The production of the aptamer of the invention can be carried out following conventional methods in the art. Non-limiting examples of aptamer production techniques include enzymatic techniques, such as transcription, recombinant expression systems and standard solid phase (or solution phase) chemical synthesis, commercially available. When appropriate, for example, in the event that the aptamer of the invention comprises variants of nucleic acids such as those described above, nucleotide analogs such as analogs having chemically modified bases or sugars, skeleton modifications, etc., the aptamer of the invention will be produced by chemical synthesis. Alternatively, recombinant expression will be the preferred technique for the production of aptamers when they are 200 nucleotides in length or greater. The aptamers produced by any of the prior art can, optionally, be purified by methods well known in the art.
    Invention Complex
    As the person skilled in the art will be able to appreciate, the characteristics of small size, stability and easy production of the aptamer of the invention, make it possible to present it attached to a second molecule. This is particularly advantageous when the second molecule is a functional group. The result of the union of the aptamer of the invention and a functional group is a complex that exhibits the combination of functions of both, that is, a complex with the ability to specifically bind and inhibit TLR-4 and with the activity associated with the group. functional.
    Therefore, in another aspect, the present invention relates to a complex, hereinafter referred to as the ucomplex of the invention ", which comprises a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEa ID NO: 2 or a functionally equivalent variant thereof and a functional group.
    P201 430955
    The term "aptamer" has been described in detail in relation to the Definitions and the specific Atamer of TLR-4 (supra) and its definitions and particularities apply equally in the context of the complex of the invention.
    The term "functional group", in the context of the present invention, refers to molecules capable of exercising at least one function. Such function includes, without limitation, the ability to specifically bind to TLR-4 or other TLR receptors, the ability to inhibit TLR4 or other TLR receptors, the ability to be detectable, both directly and indirectly, the ability to induce cell death, etc. As the person skilled in the art will understand, a functional group may have one or multiple functions associated. Non-limiting examples of functional groups include detectable reagents and drugs. These functional groups can be acting as imaging agents, drugs, etc.
    Therefore, in a particular embodiment, the functional group is selected from a detectable reagent and a drug.
    In another particular embodiment, the functional group is a detectable reagent. The term "detectable reagent", in the context of the present invention, refers to reagents capable of being directly or indirectly detectable. Examples of detectable reagents indicated for the present invention include, without limitation, radionuclides, fluorophores, proteins and haptens.
    In a preferred embodiment, the detectable reagent is a radionuclide. For this purpose, appropriate radionuclides have utility in diagnostic imaging techniques, such as radioimmunodiagnostic and positron emission tomography (PET) techniques. Non-limiting examples of radionuclides include gamma emission isotopes, such as 99mTc, 1231 and 1111n, which can be used in radioscintigraphy using gamma cameras or gamma cameras or computed single photon emission tomography, as well as positron emitters, such as 18F, 64Cu, 68Ga, 86y, 1241, 213Si and 211At, which can be used in PET,
    or beta emitters, such as 131 1, 9OY, 99mTc, 177Lu and 67CU. "The person skilled in the art will appreciate that radionuclides can also be used for therapeutic purposes.
    In another preferred embodiment, the detectable reagent is a fluorophore. The term "fluorophore", in the context of the present invention, refers to a fluorescent chemical compound that can emit light after being excited by a light of different wavelength. Suitable fluorophores in the present invention include, without limitation, Cy3, Cy2, Cy5, the

    family of fluorescent markers Alexa Fluor® (Molecular Probes, Inc.), carboxyfluorescein (FAM) and f1uorescein isothiocyanate (File).
    In another preferred embodiment, the detectable reagent is a protein. The term "protein", in the context of the present invention, refers to macromolecules consisting of one or more amino acid chains. Proteins are responsible for carrying out a diverse group of cellular functions based on their ability to bind other molecules specifically. Proteins can bind to other proteins as well as small substrate molecules. Non-limiting examples of proteins suitable for the purposes of the present invention include, without limitation, enzymes, fluorescent proteins, luminescent proteins and antigens.
    In an even more preferred embodiment, the protein is an enzyme. The term "enzyme", in the context of the present invention, refers to a protein that functions as a highly selective catalyst, accelerating both the speed and the specificity of the metabolic reaction for which it is specific. Non-limiting examples of enzymes suitable for the invention include, without limitation, horseradish peroxidase (in English "horseradish peroxydase", HRP) and alkaline phosphatase. As one skilled in the art will appreciate, the enzymes suitable for use in the present invention are indirectly detectable thanks to their ability to catalyze modifying a substrate in a compound detectable by colorimetry, chemiluminescence or fluorometry. Examples of suitable substrates include, without limitation, p-Nitrophenyl phosphate (PNPP), 2,2'-azinobis [3-ethylbenzothiazolin-6-sulfonic acid] (ABTS), o-phenylenediamine (OPD), and 3.3 ', 5, 5'-tetramethylbenzidine (TMB).
    Bioluminescent proteins or photoproteins are a particular case of oxidative enzymes that are capable of carrying out a chemical reaction of their specific prosthetic groups, resulting in an emission of light without the need for prior excitation. Non-limiting examples of bioluminescent proteins include firefly luciferase, Renilla luciferase and aquorin.
    In another even more preferred embodiment, the protein is a fluorescent protein. The term "fluorescent protein", in the context of the present invention, refers to a protein capable of emitting light when excited at a wavelength suitable for excitation. Non-limiting examples of fluorescent proteins that can be used in the complex of the invention include, without limitation, GFP, GFPuv, BFP, CFP, YFP, EBFP2,
    P201 430955
    mCerulean, mCerulean3, mVenus, mTurquoise, T-Sapphire, citrine, amFP486, zFP506, zFP538, drFP, DsRed, mCherry, dTomato, mTFP1, TagRFP-T, mK02, mRuby, mKate, mAmetrine, RE- rhine-Rhine-Rh-rhine PE) and allophycocyanin (APC).
    In another even more preferred embodiment, the protein is a luminescent protein. The term "luminescent protein", in the context of the present invention, refers to a protein capable of emitting light when excited at a wavelength suitable for its excitation. Non-limiting examples of fluorescent proteins that can be used in the complex of the invention include, without limitation, the proteins collected in Table 1, together with their corresponding excitation and emission wavelengths.
    In another even more preferred embodiment, the protein is an antigen. The term "antigen", in the context of the present invention, refers to a molecule that induces an immune response in the body. Therefore, an antigen can be used to generate an antibody that recognizes it and specifically binds to it. Non-limiting examples of antigens include, among others, tumor antigens, such as the carcinoembryonic antigen (CEA), HER2, the prostate specific antigen (PSA) and the tissue plasminogen activator and its recombinant variants such as Activase®, as well as bacterial antigens , allergens, etc. As one skilled in the art will appreciate, antigens suitable for use in the present invention are indirectly detectable thanks to their ability to be specifically recognized by an antibody.
    In another preferred embodiment, the detectable reagent is a hapten. The term "hapten", in the context of the present invention, refers to a group of chemical compounds of small molecular size "10,000 Da) that are antigenic but unable to induce a specific immune reaction on their own. The chemical coupling of a hapten to a large immunogenic protein, called a carrier, generates an immunogenic hapten-carrier conjugate that is capable of inducing a specific immune reaction. Non-limiting examples of vitamins include biotin (vitamin B7), digoxigenin, dinitrophenol (DNP) and nitro-iodophenol (NIP). In a more preferred embodiment, the vitamin is biotin. The term "biotin", in the context of the present invention, refers to a heat-stable vitamin, soluble in water and alcohol, also called vitamin H and vitamin B7, characterized by specifically binding avidin with the highest affinity described up to the date of Kd = 10-15 M. As one skilled in the art will appreciate, biotin is indirectly detectable thanks to its ability to be specifically recognized by avidin or variants thereof as streptavidin and neutravidin.

    In another particular embodiment, the functional group is a drug. The term "drug", in the context of the present invention, refers to a chemical substance used in the treatment, cure or prevention of a disease or condition, such as a pathology characterized by an increase in TLR-4 expression and / or an increase in TLR activation
    4. The term "pathology characterized by an increase in TLR-4 expression and / or an increase in TLR-4 activation" is described in detail in the context of the medical uses of the invention and its definition and particularities are included herein. by reference
    The person skilled in the art will immediately know which agents are indicated for the treatment of a particular disease. Almost all the agents indicated for the treatment of a pathology characterized by an increase in TLR-4 expression and / or an increase in TLR-4 activation can be comprised in the complex of the invention, although TLR antagonist agents -4 and anti-inflammatory agents are particularly preferred. Although numerous types of drugs can be used in the context of the invention, in a preferred embodiment, the present invention contemplates that the drug is selected from the group that includes, without limitation, TLR-4 antagonists, such as naloxone, naltrexone, LPS , idulilast, propentophilin, amitriptyline, quetotifen, cyclobenzaprine, mianserin and imipramine; platelet antiaggregants, such as aspirin and clopidogrel; anti-coagulants, such as heparin, acenocoumarol, warfarin, dabigatran and rivaroxaban; and antioxidants, such as edaravone. Although it has already been mentioned in the context of detectable reagents, the tissue plasminogen activator and its recombinant variants can also be considered as a drug because of its thrombolytic action.
    The present invention contemplates that the drug is a nucleic acid. Thus, in a preferred embodiment the drug is a nucleic acid. Nucleic acids suitable as drugs in the context of the complex of the invention include antisense RNA, antisense DNA and small interfering RNAs, which possess the ability to silence the expression of genes involved in a pathology characterized by increased expression of TLR-4 and / or an increase in TLR-4 activation, including, without limitation, the NFKB1> RIPK3, IFNB1, LY96 (MD-2), IRF3, TLR3, TlRAP (Ma0, TlCAMl (TRIF), RIPK1, TRAF6, CDI4 genes , TRA M, IKBKG (/ KK-gamma), IFNA1 and TLR4. The term "antisense URNA", in the context of the present invention, refers to a single stranded RNA whose nucleotide sequence is complementary to a target messenger RNA, interfering with this with the expression of the respective gene The term "antisense DNA", in the context of the present invention, is
    P201 430955
    refers to a single stranded DNA whose nucleotide sequence is complementary to a
    Target messenger RNA, interfering or silencing it with the expression of the respective gene. The term "small interfering RNA" or "siRNA" or "siRNA (small interfering RNA"), in the context of the present invention, refers to a double stranded RNA with a length of 20 to 25 nucleotides that is highly specific. for the nucleotide sequence of its target messenger RNA, thereby interfering with the expression of the respective gene.
    The present invention contemplates that the drug is a peptide. Thus, in a preferred embodiment the drug is a peptide. The term "peptide", in the context of the present invention, refers to a short chain of amino acids linked by peptide bonds. The peptide will comprise at least 2 amino acids, at least 3 amino acids, at least 4 amino acids, at least 5 amino acids, at least 10 amino acids, at least 15 amino acids, at least 20 amino acids, at least 30 acidic amino acids, at least 40 amino acids, at at least 50 amino acids, at least 60 amino acids, or at least 70 amino acids. Suitable for the purposes of this invention are, among others, peptides capable of binding to a target and inducing or inhibiting cell signaling. The term "target binding peptide", in the context of the present invention, refers to a peptide comprising a target binding region. The term "signaling peptide", in the context of the present invention, refers to a peptide with the ability to cause cell signaling, such as cell receptor agonist peptides. Suitable amino acid sequences for the binding of target molecules include consensus sequences of molecular recognition well known in the art.
    The union between an aptamer of the invention and a functional group to generate the complex of the invention can be carried out by conjugation techniques widely known to those skilled in the art. The result is a covalent bond between the aptamer of the invention and the functional group. Conjugation may involve the binding of primary amines of the 3 'or 5' ends of the aptamer of the invention to the functional group during the chemical synthesis of the aptamer. Alternatively, the conjugation can be carried out by conventional cross-reaction reactions (in English "cross-linking"), which have the advantage of the much greater chemical reactivity of primary alkyl amine tags against the aryl amines of the nucleotides themselves. The conjugation methods are well known in the art and are based on the use of cross-linking reagents. Crosslinking reagents contain at least two reactive groups, which target groups such as primary amines,

    sulfhydryls, aldehydes, carboxyls, hydroxyls, azides and so on, in the molecule to be conjugated. Crosslinking agents differ in chemical specificity, spacer arm length, spacer arm composition, cleavage spacer arm, and structure. For example, the conjugation of complexes according to the invention can be carried out directly or through a linker moiety, through one or more non-functional groups in the aptamer and / or the functional group, such as amine, carboxyl, phenyl groups, thiol or hydroxyl. More selective bonds can be achieved through the use of a heterobifunctional linker. Conventional linkers can be used, such as diisiocyanates, diisothiocyanates, bis (hydroxysuccinimide) esters, carbodiimides, maleimide-hydroxysuccinimide esters, glutaraldehyde and the like, ° hydrazines and hydrazides, such as 4- (4-N-maleimidophenyl) butyl acid hydrazide (MPBH)
    Another approach is the labeling of aptamers during PCR synthesis by using primers labeled, for example, with a fluorophore. For this, there are several commercial houses available for the expert in the field.
    Additionally, in the particular embodiment in which the functional group is a radionuclide, the bonding between an aptamer according to the invention and the radionuclide can be carried out by chemical coordination, wherein the atoms of the aptamer involved in the bond donate electrons to the radionuclide. Coordination reactions are widely known in the art and will depend on the radionuclide and the reactive group involved in the aptamer.
    In vitro uses of the invention
    A. In vitro uses to detect TLR-4
    The present invention also contemplates in vitro uses of a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEO ID NO: 2 or a variant functionally equivalent thereof, and of a complex comprising a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEO ID NO: 1 and SEO ID NO: 2 or a functionally equivalent variant thereof and a functional group, to detect TLR-4.

    Therefore, in another aspect, the present invention relates to an in vitro use of a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEO ID NO: 1 and SEO ID NO: 2 or a functionally equivalent variant thereof to detect TLR
    Four.
    Thus, the ability of an aptamer according to the invention to specifically bind TLR-4 can be exploited for indirect detection of TLR-4 through the aptamer according to the invention. For this purpose, the person skilled in the art will recognize that a subsequent detection of said aptamer is necessary. Aptamer detection techniques are widely known in the art and include, for example, the use of antibodies or specific probes against the aptamer. Thus, once the aptamer according to the invention is bound to TLR-4, an antibody or probe specific to the aptamer would be applied, which in turn can be labeled with a detectable reagent, or which can be detected indirectly. by an antibody or secondary probe. The technique used to detect TLR4 will then depend on the type of detectable reagent, which may be techniques based, for example, on fluorimetry, colorimetry or radioactivity.
    The term "probe" or "hybridization probe", in the context of the present invention, refers to a DNA or RNA fragment of variable length, generally between 10 and 1000 bases in length, which is used to detect the presence of single stranded nucleic acids (DNA or RNA) that are complementary to the sequence in the probe.The probe hybridizes to the target single stranded nucleic acid, whose base sequence allows base pairing due to the complementarity between the probe and the target nucleic acid To detect the hybridization of the probe to its target sequence, the probe is labeled with a detectable reagent, such as a radionuclide, a fluorophore or digoxigenin, among others.
    The detection of TLR-4 with the aptamer of the invention can be carried out by in vitro binding assays, such as the enzyme-linked oligonucleotide assay (in English "Enzyme-Linked OligoNucleotide Assay", ELONA), the assay by Enzyme-linked absorption by enzymes (in English "Enzyme-Linked Apfamer Sorbent Assay", ELASA), precipitation and quantitative PCR (qPCR), gel mobility shift assay (in English "gel mobility shift assay"), Western Blotting, superticial plasmon resonance (in English "surface plasman resonance», SPR), kinetic capillary electrophoresis, the binding assay of
    P201 430955
    fluorescence, aptahistochemistry, aptacytochemistry, fluorescence microscopy or flow cytometry.
    In another particular embodiment of the in vitro uses of the invention, the detection of TLR-4 is performed by a method selected from the group consisting of ELONA, aptacytochemistry, aptahistochemistry and flow cytometry.
    The term "ELONA" or "enzyme-linked oligonucleotide assay" (in English "EnzymeUnked OligoNucleotide Assay"), in the context of the present invention, refers to a technique analogous to enzyme-linked immunoassay (in English ~ Enzyme -Unked ImmunoSorbent Assay ", ELlSA), where the antibody used to detect the molecule of interest, in this case TLR-4, is exchanged for a specific detection aptamer for said molecule. The ELlSA assay is based on the use of labeled antigens or antibodies, for example with enzymes, so that the complexes formed between the target antigen and the labeled antibody are enzymatically active complexes, since one of the components, in this case the antigen, is immobilized on a support, Antigen: antibody complexes are immobilized to the support and, therefore, can be detected by the addition of a specific substrate of the enzyme.In the case of ELONA, the aptamer of detection can be covalently linked to an enzyme,
    or it can itself be detected by a secondary antibody specific to the aptamer that is conjugated to an enzyme. Said enzyme catalyzes the transformation of a specific substrate to produce a visible signal. This technique can be modified to exchange the enzyme for another detectable reagent, such as a fluorophore. The terms ELONA and ELASA are used herein, or enzyme-linked aptamer absorption assay ("Enzyme-Unked Aptamer Sorbent Assay"), interchangeably. In a preferred embodiment the detection of TLR-4 is performed by ELONA.
    Similarly, the terms "aptacitoguímica" and "aptahistoguímica", in the context of the present invention, refer to techniques analogous to immunocytochemistry and immunohistochemistry for the detection of TLR-4 on cells and histological sections, respectively, where the antibody that is used to detect the molecule of interest, in this case TLR-4, is exchanged for a specific aptamer for said molecule. The detection aptamer can be covalently linked to an enzyme, or it can itself be detected by a secondary antibody specific to the aptamer that is conjugated to an enzyme. Said enzyme catalyzes the transformation of a specific substrate to produce a visible signal. This technique can be modified to exchange the enzyme

    by another detectable reagent, such as a fluorophore. In a preferred embodiment the detection of TLR-4 is performed by aptacytochemistry. In another preferred embodiment the detection of TLR-4 is performed by aptahistochemistry.
    Alternatively, the person skilled in the art will recognize that these techniques (ELONA, aptacytochemistry, aptahistochemistry) can be adapted to exchange the detection antibody for a specific probe of the aptamer.
    The term "flow cytometry", in the context of the present invention, refers to a cell analysis technique that involves measuring the light scattering and fluorescence characteristics that cells possess as they are passed through a beam of light. light. In addition to light scattering, if cells are placed prior to analysis in the presence of aptamers labeled with fluorescent molecules, it can be evaluated which cells possess the antigens complementary to the aptamers used. Fluorescence detection is performed with flow cytofluorimeters (known as "cytometers" or "FACS"). This technique, like the previous ones, was initially developed for use with antibodies fluorescently labeled but can be easily adapted for use with the aptamer of the invention.
    As one skilled in the art will appreciate, a complex comprising a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEO ID NO: 1 and SEO ID NO: 2 or a functionally equivalent variant thereof and a detectable reagent is particularly advantageous for detecting TLR-4, since said detectable reagent enables the detection of the aptamer comprised in the complex when bound to TLR-4. The technique used to detect TLR-4 will depend on the type of detectable reagent, which may be techniques based, for example, on fluorimetry, colorimetry or radioactivity.
    Thus, in another aspect, the present invention relates to a complex comprising a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEO ID NO: 1 and SEO ID NO: 2 or a functionally equivalent variant thereof and a functional group to detect TLR-4.
    In a particular embodiment, the functional group is a detectable reagent.
    P201 430955
    In another particular embodiment of the in vitro uses of the invention, the detection of TLR-4 is performed by a method selected from the group consisting of ELONA, aptacytochemistry, aptahistochemistry and flow cytometry.
    The terms "aptamer", "TLR ~", "complex", "function group," detectable reagent "," ELONA "," aptacytochemistry "," aptahistochemistry "and" flow cytometry "have been described in detail above and their definitions and particularities are included here by reference.
    10 Since the techniques of ELlSA, immunocytochemistry, immunohistochemistry and flow cytometry are well known in the art, the person skilled in the art will be able to make the necessary adaptations to exchange the antibody for the aptamer or complex according to the invention without the need for experimentation. improper
    15 B. In vitro uses to inhibit TLR-4
    As described above, a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEO ID NO: 1 and SEO ID NO: 2 or a variant Functionally equivalent thereof can inhibit the activity of TLR-4, reducing the levels of pro-inflammatory cytokines released as a result of their activation. The present invention also contemplates in vitro uses of a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEO ID NO: 1 and SEO ID NO: 2 or a variant functionally
    25 equivalent thereof, and a complex comprising a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEO ID NO: 2 or a functionally equivalent variant thereof and a functional group, to inhibit TLR-4.
    Therefore, in another aspect, the present invention relates to an in vitro use of a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEO ID NO: 1 and SEO ID NO: 2 or a functionally equivalent variant thereof to inhibit TLR ~.
    In another aspect, the present invention relates to an in vitro use of a complex comprising a nucleic acid aptamer capable of specifically binding and

    inhibit TLR-4 and which comprises a sequence selected from the group consisting of SEO ID NO: 1 and SEO ID NO: 2 or a functionally equivalent variant thereof and a functional group, to inhibit TLR-4.
    5 In vitro methods of the invention
    A. In vitro methods for the detection of TLR-4
    In another aspect, the present invention relates to an in vitro method for the detection of TLR-4 in a sample, hereinafter "the first in vitro method of detecting TLR-4 of the invention" comprising
    i) contacting said sample with a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEO ID NO: 1 and SEO ID NO: 2
    15 or a functionally equivalent variant thereof, ii) separating the aptamer not bound to TLR-4, and iii) detecting the presence of the aptamer bound to the TLR-4 present in the sample.
    In a first stage, the first in vitro method of detection of the invention comprises
    20 contacting said sample with a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEO ID NO: 1 and SEO ID NO: 2 or a functionally equivalent variant from the same.
    25 The terms "aptamer" and "TLR-4 ~ have been described in detail above and their definitions and particularities are included herein by reference.
    The term "sample" or "biological sample", in the context of the present invention, refers to a cell culture or biological material isolated from a subject. The biological sample
    30 may contain any suitable biological material to detect the desired biomarker and may comprise cells and / or non-cellular material of the subject. The sample can be isolated from any suitable tissue or biological fluid such as, for example, blood, plasma, serum, urine, cerebrospinal fluid (CSF), heart, brain. The samples used for the detection of TLR-4 are preferably biological fluids.
    P201 430955
    Alternatively, the samples are samples of biofluids. The terms "biological fluid" and "biofluid" are used interchangeably herein and refer to aqueous fluids of biological origin. The biofluid can be obtained from any location (such as blood, plasma, serum, urine, bile, cerebrospinal fluid, vitreous or aqueous humor, or any body secretion), an exudate (such as fluid obtained from an abscess or any other site of infection or inflammation), or the fluid obtained from a joint (such as a normal joint or a joint affected by a disease such as rheumatoid arthritis). The biofluids used for the detection of TLR-4 are preferably samples of blood, plasma, serum or cerebrospinal fluid.
    The aptamer according to the invention is applied on the sample in a suitable buffer to allow attachment of the aptamer to the TLR-4 molecules that may be present in the sample. Non-limiting examples of suitable buffers to allow binding of the aptamer of the invention and TLR-4 include PBS, TBS, phosphate buffer and citrate buffer. Preferably, these buffers contain 1mM MgCb. The amount of aptamer necessary to detect the TLR-4 molecules present in the sample will depend on both the sample size and the amount of TLR-4 present in the sample, and can be easily determined by optimization procedures that are common in The technique. For guidance, the aptamer concentration is at least 1 fM, at least 10 fM, at least 100 fM, at least 1 pM, at least 10 pM, at least 100 pM, at least 1 nM, at least 10 nM, at least 100 nM, at least 1 ~ M, at least 10 ~ M, at least 100 ~ M or more. Preferably, the concentration of aptamer is between 100 fM and 1 ~ M, more preferably between 1 pM and 100 nM, even more preferably between 100 pM and 1 nM.
    The aptamer is incubated with the sample at a suitable temperature and for a time sufficient to allow attachment of the aptamer to the TLR-4 molecules that may be present in the sample. The temperature is preferably between 20 ° C and 37 ° C. For guidance, the aptamer will be incubated with the sample for at least 5 min, at least 10 min, at least 15 min, at least 20 min, at least 30 min, at least 60 min, at least 120 min or more.
    Once the aptamer has bound to the TLR-4 molecules that may be present in the sample, in a second stage the sample is washed to remove the aptamer molecules that have not bound to TLR-4.

    In a third stage the presence of the aptamer bound to the TLR-4 present in the sample is detected. Since the aptamer of the invention is not itself a detectable molecule, the detection stage is an indirect detection stage through a second detectable molecule that specifically binds to the aptamer. The detection of the TLR-4 bound aptamer can be carried out with virtually any known antibody or reagent that binds with high affinity to the aptamer of the invention. However, it is preferable to use a specific antibody against the aptamer, for example, polyclonal serum, hybridoma supernatants, monoclonal or humanized antibodies and fragments thereof. Said aptamer specific antibody is conveniently labeled with a detectable reagent. The term "detectable reagent" has been described in detail above and its definition and particularities are included herein by reference. Said reagent can be detected by means of fluorimetry or colorimetry using apparatus suitable for the type of reagents and the type of sample, which are known to the person skilled in the art. By way of example, the sample with the aptamer bound to the TLR-4 molecules present is incubated with an aptamer specific antibody is conjugated to an enzyme, under conditions similar to the conditions of incubation with the aptamer, and the TLR- complexes 4-aptamer-antibody are detected with the addition of a substrate that is converted by the enzyme to a detectable product, for example, by fluorimetry in a fluorescence microscope or by colorimetry in a spectrophotometer. Alternatively, the detection can be performed analogously by using a specific probe of the aptamer conveniently labeled with a detectable reagent. The person skilled in the art will recognize that the first in vitro method of the invention can be carried out as part of detection techniques such as ELONA, ELASA, precipitation and qPCR, gel mobility change assay, Western Blotting, surface plasmon resonance , kinetic capillary electrophoresis, fluorescence binding assay, aptahistochemistry, aptacytochemistry, fluorescence microscopy or flow cytometry.
    Alternatively, the aptamer according to the invention may be linked to a functional group as part of a complex according to the invention. Therefore, in another aspect, the present invention relates to an in vitro method for the detection of TLR-4 in a sample, hereinafter "the second in vitro method of detecting TLR-4 of the invention", which comprises
    i) contacting said sample with a complex comprising an aptamer of
    nucleic acid capable of specifically binding and inhibiting TLR-4 and that
    It comprises a sequence selected from the group consisting of SEQ ID NO:

    and SE ID NO: 2 or a functionally equivalent variant thereof and a
    functional group, ii) separate the aptamer or complex not bound to TLR-4, and iii) detect the presence of the complex bound to the TLR-4 present in the sample.
    The terms "aptamer", "TLR-4" and "sample" have been described in detail above and their definitions and particularities are included herein by reference. Similarly, the particularities of the first and second stages of the first in vitro detection method of the invention also apply to the second in vitro method of detection of the invention and are
    10 also include by reference.
    The third stage of the second in vitro method of detecting the invention comprises detecting the presence of the complex of the invention bound to the TLR-4 present in the sample. The detection of the complex according to the invention can be carried out with practically any known antibody or reagent that binds with high affinity to the aptamer of the invention or to the functional group. The detection of the aptamer of the invention has been described in detail in the context of the first in vitro method of detection of the invention. Similarly, in relation to the functional group, detection can also be carried out with virtually any known antibody or reagent that binds with high affinity to said
    20 functional group. For this reason, it is particularly convenient for the second in vitro method of detection of the invention that the functional group be a detectable reagent.
    In a particular embodiment the functional group is a detectable reagent selected from the group consisting of radionuclides, fluorophores, proteins and haptens.
    The terms "radionuclide", "fluorophore", "detectable protein" and "hapten" have been described in detail above and their definitions and particularities are included herein by reference.
    As will be appreciated by the person skilled in the art, the detectable reagents contemplated by the present invention can be divided between reagents that are directly detectable by themselves, such as radionuclides or fluorophores, and reagents that are indirectly detectable, such as proteins or haptens.
    In a preferred embodiment, the detectable reagent is a radionuclide and the detection is performed by detecting the radiation emitted by the radionuclide. This radiation will depend
    P201 430955
    of the radionuclide type, which may be an emission of particles a, particles ¡3 or emission of
    type y. For this purpose, suitable detection techniques for different radionuclides are widely known. As an example, the emission emitted by 1231 can be detected by a gamma camera.
    In another preferred embodiment, the detectable reagent is a fluorophore and the detection is performed by detection of the fluorescence emitted by the fluorophore. The use of a fluorophore requires its prior excitation with a wavelength within its excitation spectrum, which causes an emission at a different wavelength. The excitation and emission wavelengths of the fluorophores contemplated in the present invention form part of the state of the art. The emitted fluorescence can be detected, for example, by fluorimetry techniques using a fluorescence spectrophotometer or a fluorescence microscope.
    In another preferred embodiment, the detectable reagent is a protein. This can be detected
    Depending on the type of protein used. For example:
    an enzyme requires the addition of its specific substrate that will be detectable by
    colorimetry, chemiluminescence or fluorimetry;
    a fluorescent protein, like a fluorophore, requires excitation to a
    suitable wavelength to be detectable by fluorimetry (for example, the
    wavelengths shown in Table 1);
    an antigen or a hapten requires an antibody or other molecule that recognizes it
    specifically. In order to be detected, said antibody or specific molecule
    for the antigen / hapten it needs to be labeled, for example, with an enzyme, and the
    Detection will depend on the type of marking.
    The person skilled in the art will recognize that the second in vitro method of the invention can be carried out as part of detection techniques such as ELONA, ELASA, precipitation and qPCR, gel mobility change assay, Western Blotting, plasma resonance superficial, kinetic capillary electrophoresis, fluorescence binding assay, aptahistochemistry, aptacytochemistry, fluorescence microscopy or flow cytometry.
    In a particular embodiment, the detection of TLR-4 is performed by means of fluorescence.
    B. In vitro methods for the inhibition of TLR-4
    P201 430955
    In another aspect, the present invention relates to an in vitro method for inhibiting TLR-4 in a sample, hereinafter "the first in vitro method of inhibiting TLR-4 of the invention", which comprises contacting a sample that comprises TLR-4 with a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEO ID NO: 1 and SEO ID NO: 2 or a functionally equivalent variant of the themselves, under appropriate conditions inhibit TLR
    Four.
    The terms "aptamer", "TLR-4", "inhibition of TLR-4" and "sample" have been described in detail above and their definitions and particularities are included herein by reference.
    In a particular embodiment, the TLR-4 of the sample is comprised of living cells.
    The first in vitro method of inhibiting TLR-4 of the invention comprises contacting a sample comprising TLR-4 with an aptamer according to the invention under suitable conditions to inhibit TLR-4. For this, the aptamer is applied of the invention on the sample and must be attached to TLR-4.
    The term "suitable conditions to inhibit TLR-4", in the context of the present invention, refers to the incubation conditions that allow the attachment of the aptamer of the invention to TLR-4 and its subsequent inhibition. These conditions include the composition of the buffer in which the aptamer of the invention is applied on the sample, the amount of aptamer, the incubation time and the incubation temperature. Non-limiting examples of suitable buffers to allow binding of the aptamer of the invention to TLR-4 and its inhibition include PBS, TBS, phosphate buffer and citrate buffer. Preferably, these buffers contain 1mM MgCI2. The amount of aptamer necessary to detect the TLR-4 molecules present in the sample will depend on both the sample size and the amount of TLR-4 present in the sample, and can be easily determined by optimization procedures that are common in The technique. For guidance, the aptamer concentration is at least 1 fM, at least 10 fM, at least 100 fM, at least 1 pM, at least 10 pM, at least 100 pM, at least 1 nM, at least 10 nM, at least 100 nM, at least 1 IJM, at least 10 IJM, at least 100 IJM or more. Preferably, the concentration of aptamer is between 100 fM and 1 IJM, more preferably between 1 pM and 100 nM, even more preferably between 100 pM and 1 nM.
    P201 430955
    The aptamer is incubated with the sample at a suitable temperature and for a time sufficient to allow attachment of the aptamer to the TLR-4 molecules that may be present in the sample. The temperature is preferably between 20 ° C and 37 ° C, more preferably 37 ° C. For guidance, the aptamer will be incubated with the sample
    5 for at least 5 min, at least 10 min, at least 15 min, at least 20 min, at least 30min, at least 60 min, at least 120 min or more.
    In another aspect, the present invention relates to an in vitro method for inhibiting TLR-4 in a sample, hereinafter "the second in vitro method of inhibiting TLR-4 of the
    10 ", which comprises contacting a sample comprising TLR-4 with a complex comprising a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEa ID NO: 1 and SEa ID NO: 2 or a functionally equivalent variant thereof and a functional group under suitable conditions inhibit TLR-4.
    The terms "aptamer", "TLR-4", "inhibition of TLR-4", "sample" and "suitable conditions inhibit TLR-4" have been described in detail above and their definitions and
    particularities are included here by reference.
    20 Medical uses of the invention
    The authors of the present invention have demonstrated that the aptamer of the invention is capable of blocking or inhibiting the volume of infarction produced in a model of induced stroke in experimental animals, as described in Example 4. Therefore, The ability of the aptamer of the invention to specifically bind and inhibit TLR-4 makes it therapeutic. It is apparent that the therapeutic effect obtained with the aptamer of the invention can be complemented with a functional group with therapeutic activity, as described in the context of the complex of the invention. Accordingly, the present invention contemplates the medical uses of the aptamer. of the
    30 invention and of the complex of the invention
    A. Medical uses of the aptamer of the invention
    In another aspect, the present invention relates to a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence.
    P201 430955
    selected from the group consisting of SEO ID NO: 1 and SEa ID NO: 2 or a functionally equivalent variant thereof for use in medicine.
    In another aspect, the present invention relates to a nucleic acid aptamer capable of specifically binding and inhibiting TLR4 and comprising a sequence selected from the group consisting of SEO ID NO: 1 and SEa ID NO: 2 or a functionally variant equivalent thereof for use in the manufacture of a medicament for the treatment of a pathology characterized by an increase in TLR-4 expression and / or an increase in TLR-4 activation.
    Alternatively, it can be expressed as the use of a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEO ID NO: 1 and SEa ID NO: 2 or a variant functionally equivalent thereof for use in the treatment of a pathology characterized by an increase in TLR-4 expression and / or an increase in TLR activation
    Four.
    Alternatively, it can be expressed as an in vivo method of treating a pathology characterized by an increase in TLR-4 expression and / or an increase in TLR4 activation in a subject, comprising administering to said subject a therapeutically effective amount of a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEa ID NO: 1 and SEa ID NO: 2 or a functionally equivalent variant thereof to said subject.
    According to the invention, a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEa ID NO: 1 and SEa ID NO: 2 or a functionally equivalent variant of they specifically bind to TLR-4 on the surface of a target cell. By contacting the aptamer of the invention TLR-4 inhibits its activity, resulting in a reduction or interruption in the release of pro-inflammatory cytokines such as IL-1, IL8, TNF-alpha and IL-12.
    The term "aptamer" has been described in detail in relation to the Definitions and the specific Atamer of TLR-4 (supra) and its definitions and particularities apply equally in the context of the complex of the invention.
    P201 430955
    The term "treatment" or "therapy", in the context of the present invention, refers to clinical intervention in an attempt to prevent, cure, delay, reduce the severity of, or improve one or more symptoms of the pathology characterized by an increase in TLR-4 expression and / or an increase in TLR-4 activation, or in order to prolong a patient's survival beyond that expected in the absence of such treatment.
    The term "target cell", in the context of the present invention, refers to the particular cell expressing TLR-4, which includes, among others, myeloid lineage cells such as monocytes, macrophages, microglia cells, granulocytes and dendritic cells immature, as well as cells of other lineages such as neurons, etc. In a particular embodiment, the target cell is a monocyte or a macrophage. In another particular embodiment, the target cell is a microglia cell. In another particular embodiment, the target cell is a granulocyte. In another particular embodiment, the target cell is an immature dendritic cell. In another particular embodiment, the target cell is a neuron.
    In a particular embodiment, the target cell is a mammalian cell. In another preferred embodiment, the mammalian cell is a human cell.
    The term "subject" or "individual" refers to a member of a mammalian species, and
    includes, but is not limited to pets, and primates including humans; The subject is preferably a human being, male or female, of any age or race.
    The term "a therapeutically effective amount", in the context of the present invention, refers to the amount of the aptamer of the invention that is required to achieve a prevention, cure, delay, reduction of the severity of, or improvement of one or more appreciable symptoms of the pathology characterized by an increase in TLR-4 expression and / or an increase in TLR-4 activation.
    The term "pathology characterized by an increase in TLR-4 expression and / or an increase in TLR-4 activation", in the context of the present invention, refers to a pathology in which cells expressing TLR-4 show an increase in TLR-4 expression and / or an increase in TLR-4 activation with respect to normal or reference physiological conditions or reference values, and in which said cells are directly or indirectly involved regardless of whether TLR- 4 whether or not the person responsible for the disease.

    Since the activation of TLR-4 produces a signaling cascade that results in the release of inflammatory cytokines such as IL-1, IL-8, TNF-alpha and IL-12, causing inflammation and cell damage, the pathology characterized by a increase of
    TLR-4 expression and / or an increase in TLR-4 activation may also be characterized by having an inflammatory component.
    In a particular embodiment, said pathology characterized by an increase in TLR-4 expression and / or an increase in TLR-4 activation is selected from the group formed, among others, by stroke, acute myocardial infarction, sepsis, atherosclerosis, sclerosis multiple, rheumatoid arthritis and drug addiction.
    In a preferred embodiment, said pathology characterized by an increase in TLR-4 expression and / or an increase in TLR-4 activation is stroke. The term "stroke" or "cerebrovascular disease" or "cerebral infarction or" stroke ", in the context of the present invention, refers to a pathology characterized by a neurological deficit caused by a significant decrease in cerebral blood flow, abnormally abrupt (ischemic stroke) or, due to the hemorrhage caused by the rupture of a cerebral vessel (hemorrhagic stroke) In the ischemic stroke the blood supply is lost due to the sudden and immediate interruption of blood flow, which generates the appearance of an infarcted area due to the occlusion of any of the arteries that supply the brain mass, either by accumulation of fibrin or calcium or by an abnormality in the erythrocytes, but usually it is due to atherosclerosis or by a plunger (cerebral embolism) that it comes from another location, mainly the heart or other arteries. In the hemorrhagic stroke, the rupture of a blood vessel occurs It is an efálico that, on the one hand, deprives the cerebral area dependent on that artery from irrigation, but on the other hand extravased blood exerts compression on the cerebral structures, including other blood vessels, which increases the affected area.
    In a preferred embodiment, said pathology characterized by an increase in TLR-4 expression and / or an increase in TLR-4 activation is acute myocardial infarction. The term "acute myocardial infarction" or "infarction" or "heart attack", in the context of the present invention, refers to a pathology characterized by insufficient blood supply, with tissue damage, in a part of the heart, produced by an obstruction in one of the coronary arteries. Ischemia or poor oxygen supply resulting from such obstruction produces angina pectoris, which if recanalized early does not cause tissue death
    P201 430955
    cardiac, while if this anoxia is maintained, myocardial injury occurs and finally necrosis, that is, heart attack.
    In a preferred embodiment, said pathology characterized by an increase in TLR-4 expression and / or an increase in TLR-4 activation is sepsis. The term "sepsis" or "septicemia", in the context of the present invention, refers to systemic inflammatory response syndrome (SRIS) caused by an infection, generally severe. This reaction of the organism occurs in response to the presence of pathogenic microorganisms in any tissue or fluid of the organism, and is caused by the action of the immune system itself, which releases pro-inflammatory substances that launch the SRIS. It is characterized by the presence of at least two of the following criteria: fever, hyperthermia, tachypnea, tachycardia and leukocytosis.
    In a preferred embodiment, said pathology characterized by an increase in TLR-4 expression and / or an increase in TLR-4 activation is atherosclerosis. The term "atherosclerosis", in the context of the present invention, refers to a syndrome or pathology characterized by the deposition and infiltration of lipid substances in the walls of medium and thick caliber arteries. The arterial wall cells interpret this deposit as an invasion and activate the circulating immune system monocytes, which penetrate the artery wall, become macrophages and begin to phagocyte LDL particles generating an inflammatory process. The inflammation in turn causes the multiplication and migration of smooth muscle cells in the wall, which produce narrowing of the arterial lumen. Concrete thickening is called an atheroma plaque. It is the most common form of arteriosclerosis. The diseases that form the atherosclerosis syndrome and that are characterized by involvement of the arteries by ate roma plaques and consequently obstruction of blood flow or ischemia are, depending on the artery of the affected organ:
    Ischemic heart disease, with its highest representative acute myocardial infarction,
    in the heart.
    Cerebrovascular disease, in the form of stroke or cerebral thrombosis or hemorrhage
    cerebral, in the central nervous system.
    Intermittent claudication, with its maximum severity of acute arterial ischemia of
    lower limbs.
    Erectile dysfunction: It is the main cause of impotence in people over 40
    35 years.
    P201 430955
    Ischemic colitis, is an area of inflammation (irritation and swelling) caused by
    interference with blood flow to the colon (large intestine), in the arteries of the
    bowels.
    Aortic aneurysm, with its maximum severity in aortic dissection.
    In a preferred embodiment, said pathology characterized by an increase in TLR-4 expression and / or an increase in TLR-4 activation is multiple sclerosis. The term "multiple sclerosis", in the context of the present invention, refers to a pathology characterized by the appearance of demyelinating, neurodegenerative and chronic lesions of the system.
    10 central nervous. The causes that produce it are currently unknown, although the involvement of various autoimmune mechanisms has been demonstrated. In multiple sclerosis patients, lymphocytes cross the blood-brain barrier to attack myelin, while an inflammatory process facilitated by macrophages and neuroglia cells appears.
    In a preferred embodiment, said pathology characterized by an increase in TLR-4 expression and / or an increase in TLR-4 activation is rheumatoid arthritis. The term "rheumatoid arthritis", in the context of the present invention, refers to an autoimmune systemic inflammatory pathology, characterized by causing persistent synovitis of the
    20 joints, producing its progressive destruction generating different degrees of deformity and functional disability. The process begins with the intervention of humoral and cellular factors, particularly CD4 T lymphocytes, which generate inflammation-mediating molecules, attract and activate peripheral blood cells, producing proliferation and activation of synoviocytes, invading and destroying articular cartilage, bone
    25 subchondral, tendons and ligaments.
    In a preferred embodiment, said pathology characterized by an increase in TLR-4 expression and / or an increase in TLR-4 activation is a drug addiction. The term "drug addiction" or "drug dependence" or "drug dependence", in the context of the present invention, refers to a disorder or pathology caused by frequent substance use.
    Addictive drugs or drugs. According to the ICD-10 (World Health Organization, 2005) in order to be diagnosed as such, drug addiction must present three or more of the following criteria, which refer to aspects related to both physical and psychological dependence, in a 12 month period:
    35 strong desire to consume the substance (in English craving), difficulties in controlling such consumption,
    P201 430955
    withdrawal syndrome by interrupting or reducing consumption,tolerance,progressive abandonment of interests outside the consumption of the substance,increasing investment of time in activities related to obtaining
    5 the substance or with the recovery of its effects, persistence in the use of the substance despite clearly perceiving its harmful effects.
    For administration to a subject of a nucleic acid aptamer capable of
    10 specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEO ID NO: 1 and SEO ID NO: 2 or a functionally equivalent variant thereof, said aptamer will be formulated in a suitable pharmaceutical composition. The details of said pharmaceutical composition are discussed below.
    15 B. Medical uses of the complex of the invention
    The complexes according to the present invention comprising a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEO ID NO: 1 and SEO ID NO: 2 or a Functionally equivalent variant thereof and a functional group according to the invention may comprise, as a functional group, a drug suitable for the treatment of a pathology characterized by an increase in TLR-4 expression and / or an increase in activation of TLR-4 Thus, the dual objective of (i) inhibiting the activity of TLR-4 and (ii) directing the drug specifically to its place of achievement is therefore achieved.
    25 action
    Therefore, in another aspect, the present invention relates to a complex comprising a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEO ID NO: 1 Y
    30 SEO ID NO: 2 or a functionally equivalent variant thereof and a functional group for use in medicine.
    In another aspect, the present invention relates to a complex comprising a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEO ID NO: 1 and SEO ID NO: 2 or a functionally equivalent variant thereof and a functional group for
    P201 430955
    its use in the manufacture of a medicine for the treatment of a pathology
    characterized by an increase in TLR-4 expression and / or an increase in TLR activation
    Four.
    Alternatively, it can be expressed as the use of a complex comprising a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof and a functional group for use in the treatment of a pathology characterized by an increase in TLR-4 expression and / or an increase in TLR-4 activation.
    Alternatively, it can be expressed as a method of treating a pathology characterized by an increase in TLR-4 expression and / or an increase in TLR4 activation in a subject, which comprises administering to said subject a therapeutic effective amount of a complex comprising a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof and a functional group to said subject.
    According to the invention, a complex comprising a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof and a drug specifically binds to TLR-4 on the surface of a target cell. By contacting the aptamer of the invention TLR-4 inhibits its activity, resulting in a reduction or interruption in the release of proinflammatory cytokines such as IL-1, IL-8, TNF-alpha and IL-12, and the drug exerts its function on
    cell or about the environment where said cell is located.
    The terms "aptamer", "complex", "functional group", "drug", "treatment", ~ therapeutically effective amount ", ~ subject", "target cell" and "pathology characterized by increased expression of TLR- 4 and / or an increase in activation of TLR-4 "have been described in detail above and their definitions and particularities are included herein by
    reference.
    Suitable drugs that can be used as functional groups in complexes formed with a nucleic acid aptamer capable of specifically binding and

    inhibit TLR-4 include, without limitation, TLR-4 antagonists, such as naloxone, naltrexone, LPS, idulilast, propentophilin, amitriptyline, quetotifen, cyclobenzaprine, mianserin and imipramine; platelet antiaggregants, such as aspirin and clopidogrel; anti-coagulants, such as heparin, acenocoumarol, warfarin, dabigatran and rivaroxaban; and antioxidants, such as edaravone; tissue plasminogen activator and its recombinant variants; nucleic acids that possess the ability to silence the expression of genes involved in a pathology characterized by an increase in TLR-4 expression and / or an increase in TLR-4 activation, such as antisense RNA, antisense DNA and small interfering RNA ; peptides, such as signaling peptides and target binding peptides.
    Pharmaceutical compositions
    For administration to a subject in need thereof of a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEO ID NO: 1 and SEO ID NO: 2 or a functionally equivalent variant thereof, or a complex comprising a nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEO ID NO: 1 and SEO ID NO: 2 or a functionally equivalent variant thereof and a functional group, said aptamers and complexes can be formulated in suitable pharmaceutical compositions.
    In another aspect, the present invention relates to a pharmaceutical composition, hereinafter "the first pharmaceutical composition of the invention", which comprises at least one nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a selected sequence of the group consisting of SEO ID NO: 1 and SEO ID NO: 2 or a functionally equivalent variant thereof.
    In a particular embodiment, the first pharmaceutical composition of the invention further comprises one or more pharmaceutically acceptable carriers, excipients, or solvents.
    In another aspect, the present invention relates to a pharmaceutical composition, hereinafter "the second pharmaceutical composition of the invention", comprising at least one complex comprising a nucleic acid aptamer capable of binding
    P201 430955
    specifically and inhibit TLR-4 and comprising a sequence selected from the group
    consisting of SEO ID NO: 1 and SEO ID NO: 2 or a functionally equivalent variant thereof and a functional group.
    In a particular embodiment, the second pharmaceutical composition of the invention further comprises one or more pharmaceutically acceptable carriers, excipients, or solvents.
    The pharmaceutical compositions provided by the present invention can be administered to a subject for the treatment of a pathology characterized by an increase in TLR-4 expression and / or an increase in TLR-4 activation.
    The terms "aptamer", "complex", "functional group", "drug", "treatment", "subject" and "pathology characterized by an increase in TLR-4 expression and / or an increase in TLR-4 activation "have been described in detail above and their definitions and particularities are included here by reference.
    The term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" or "pharmaceutically acceptable solvent", in the context of the present invention, is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, retarding agents. of absorption and isotonic, and the like, compatible with pharmaceutical administration. The use of such carriers and vehicles in pharmaceutically active substances is well known in the art. Except insofar as any conventional support is incompatible with the active compound, its use in the compositions of the invention is contemplated. Acceptable carriers, excipients, or acceptable stabilizers are not toxic to the subject at the doses and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride, hexamethonium chloride, benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl for benos such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol, and m -cresol); low molecular weight polypeptides (less than about 10 amino acids); proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EOTA; sugars such as

    sucrose, mannitol, trehalose or sorbitol; salt-forming counterions such as sodium;
    metal complexes (for example, Zn-protein complexes); and / or non-ionic surfactants such as TWEEN '", PLURONICS'" or polyethylene glycol (PEG).
    Supplementary active compounds can also be incorporated into the pharmaceutical composition provided by the present invention. Therefore, in a particular embodiment, the pharmaceutical composition provided by the present invention may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. For example, it may be desirable to further provide a chemotherapeutic agent, a cytokine, an analgesic agent, an anti-inflammatory agent or an immunosuppressive agent. The effective amount of said other active agents depends, among other things, on the therapeutic amount of the aptamers or complexes that are present in the pharmaceutical composition, the nature and severity of the pathology to be treated, the subject, etc.
    In one embodiment, the nucleic acid aptamer capable of specifically binding and inhibiting TLR-4 and comprising a sequence selected from the group consisting of SEO ID NO: 1 and SEO ID NO: 2 or a functionally equivalent variant of they, or the complex of the invention, are formulated with vehicles that will protect said products against rapid removal of the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable and biocompatible polymers, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. The methods for preparing such formulations will be apparent to those skilled in the art. These can be prepared according to methods known to those skilled in the art, for example, as described in the US. 4522, 811.
    The pharmaceutical compositions provided by the present invention can be administered to a subject by any suitable route of administration, such as parenterally.
    The term "parenteral", in the context of the present invention, includes intravenous, intraperitoneal, intramuscular, or subcutaneous administration. The intravenous form of parenteral administration is generally preferred.
    P201 430955
    In addition, the pharmaceutical compositions provided by the present invention can be suitably administered by pulse infusion, for example, with decreasing doses of the aptamer or complex of the invention. Preferably, the dosage is provided by injections, more preferably intravenous or subcutaneous injections, depending in part on whether the administration is brief or chronic.
    In another particular embodiment, the pharmaceutical compositions provided by the present invention can be adapted for parenteral administration with the addition of sterile solutions, suspensions or lyophilized products in the appropriate dosage form. Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions or sterile dispersions or powders for the preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, CremophorEM bacteriostatic water (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and fluid to facilitate injectability. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, a pharmaceutically acceptable polyol such as glycerol, propylene glycol, liquid polyethylene glycol, and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include in the composition isotonic agents, for example, sugars, poly alcohols such as mannitol, sorbitol, and sodium chloride. Prolonged absorption of the injectable compositions can be caused by including in the composition an agent that delays absorption, for example, aluminum monostearate and / or gelatin.
    Sterile injectable solutions can be prepared by incorporating the required amount of the active compound (for example, an aptamer or complex of the invention) in an appropriate solvent with one or a combination of the ingredients listed above, as required, followed by filtration sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and the other required ingredients of the
    P201 430955
    listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze drying which produces a powder of the active ingredient plus any additional desired ingredient from a previously filtered sterile solution of the same.
    In a particular embodiment, said pharmaceutical composition is administered intravenously. Suitable excipients may be used, such as fillers, buffering agents or surfactants. The aforementioned formulations will be prepared using standard methods such as those described or contemplated in the Spanish and US pharmacopoeias and similar reference texts.
    It is especially advantageous to formulate the pharmaceutical compositions, namely parenteral compositions, in the form of a dosage unit to facilitate administration and dosage uniformity. Dosage unit form as used herein refers to physically discrete units suitable as unit dosages for the subject to be treated; each unit containing a predetermined amount of active compound (an aptamer or complex of the invention) calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the unit dosage forms of the invention are dictated by and depend directly on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and the limitations inherent in the composition technique of such active compound for the treatment of subjects. .
    The active compounds (aptamer or complex of the invention) will typically be administered one or more times a day, for example 1, 2, 3 or 4 times daily, with typical total daily doses in the range of 0.0001 to 1,000 mg / kg body weight / day, preferably from about 0.001 to about 100 mg / kg body weight / day, more preferably from about 0.01 to 10 mg / kg body weight / day. The pharmaceutical compositions may be formulated in order to contain the desired amount, such as a therapeutically effective amount of the aptamer or complex of the invention.
    The pharmaceutical compositions provided by the present invention may be included in a container, container, or dispenser together with instructions for administration.
    P201 430955
    The invention is described below by means of the following examples that are merely illustrative and in no way limiting the scope of the invention.
    EXAMPLES
    Materials and methods
    Aptamer library The inventors used the RND40 aptamer library to carry out the selection of
    10 specific aptamers against TLR-4, supplied by IBA GmbH (Goettingen, Germany). The initial RND40 library is theoretically constituted by 1024 single-stranded DNA oligonucleotides (ssDNA) with fixed sequences at the ends, of 18 nucleotides each where the respective primers hybridize for PCR amplification, and a central region of 40 sequence bases random In the selections made they have been used
    15 1013 oligonucleotides from this library.
    6HIS-hTlR-4 Recombinant Protein corresponding to the extracellular domain of human TLR-4 protein, amino acids 24-631, was generated recombinantly fused to a label of 6
    20 histidines at the C-terminal end, by expression in baculovirus.
    CellsHEK293T and HEK293TfTLR-4 cells were obtained from Invivogen (San Diego, California,USES).
    Selection with HEK-293T-TLR4 1 HEK-293T cells. For each round of selection, 8-10 x 105 HEK-293T cells were seeded in triplicate in wells of P6 plate, 24 h before the selection test and incubated at 3rC, 5% CO2. Next, 1 nmol of aptamers from the RND40 library (or from the isolated population) was added
    30 in the previous selection round) at 100¡JI PBS, previously denatured at 95 ° C for 10 min followed by an incubation at 4 ° C for 10 min, 300¡JI of DMEM medium (Dulbecco's modified Eagle's medium) was added ) supplemented with 10% fetal bovine serum, 100 Ulml penicillin, 100 µg / ml streptomycin and 25 µg / ml amphotericin and were applied to the cells. After 1 h of incubation at 3rC, 5% CO2, the culture medium was removed with
    After the unbound aptamers, the cells were washed twice with PBS and recovered in 500 µI of PBS by centrifugation at 1500 rpm. The cells were centrifuged to remove the

    supernatant and the aptamers attached to the cells were amplified by PCR.
    Prepare enough quantity for the next round of selection.
    The counter-selection on HEK-293T cells of the RN040 aptamer library was performed
    in the previous preparation of the initial RN040 population and every 3 rounds of selection, with the population isolated from the previous selection round. For this, 8-1 0 x 105 HEK-293T cells were seeded in triplicate in wells of P6 plate, 24 h before the selection test and incubated at 3 ° C, 5% COz. Next, 1 nmol of aptamers from the RND40 library (or from the isolated population in the previous selection round) was added in 100 ¡JI PBS, previously denatured at 95 ° C for 10 min followed by a 4 ° C incubation for 10 min, 300 JI of DMEM medium (Oulbecco's modified Eagle's medium) supplemented with 10% fetal bovine serum, 100 U / mi penicillin, 100 Jg / ml streptomycin and 25 Lg / ml amphotericin were added and added. They applied on the cells. After 1 h of incubation at 3rC, 5% COz, the culture medium with unbound aptamers was removed for use in rounds of selection on TLR-4.
    Selection with soluble protein hTLR-4 For each round of selection, the RN040 library enriched in a previous selection round is used. 1 nmol of aptamers was incubated with 7 .Jg of 6xHIS-hTLR-4 (in one
    ratio of 10 aptamer molecules per 1 hTLR-4 molecule), in buffer of aptamer aptamers (20 mM Tris-HCI, pH 7.4, 1 mM MgCI2, 150 mM NaCI, 5 mM KCI), at 37'C for 1 h with agitation. Subsequently, the NTA-Ni resin (QIAGEN, Germany) was added and incubated at 4 ° C for 1 h to capture the protein. After 3 washes with aptamer buffers, the PCR bound sequences were amplified to prepare sufficient quantity for the next round of selection.
    The counter-selection is carried out under the same conditions as the selection but in the absence of resin bound TLR-4 protein.
    Amplification of the selected aptamers. The selected aptamers were resuspended in a volume of 20¡JI of distilled water and amplified by PCR using the primers, which will correspond to the sequences SEO ID NO: 5 (GCGGATGAAGACTGGTGT) and SEO ID NO: 6 (GTTGCTCGTATTTAGGGC) in the Conditions of 0.8 ~ Mlcebador SEO ID NO: 5, 0.8
    .JM / primer SEa ID NO: 6, 200 mM dNTPs, 2 mM MgClz, 10 U Taq polymerase (Biotools,
    P201 430955
    Spain) in a final volume of 200 1-11 following the following amplification program: 2
    min at 9S 'C; 1S cycles of 30 s at 9S 'C, 30 s at S6' C and 30 s at 72 'C; and finally S min at 72 'C.
    ELONA
    S It was determined whether the selected aptamers recognized the TLR-4 protein. To do this, it
    added 100 ng / well of recombinant 6xHIS-TLR-4 to a 96 microtiter plate
    wells and incubated at 4 ° C for 16 h. Subsequently, individual aptamers
    labeled with digoxigenin at its S · end, were diluted to an S I-Ig / mL concentration and
    then denatured for 10 min at 9SoC and cooled for 10 min on ice.
    10 Then, 20 pmoles of each of the aptamers in 100 1-11 (200 nM) of buffer
    Aptamers were added to each well and the plate was incubated for 1 h at 3rC. By
    Finally, the plaque was incubated with anti-digoxigenin antibodies conjugated with peroxidase and
    revealed using ABTS. A DNA aptamer against Li was used as a positive control
    H2A (Martin el al., 2013, PLoS ONE 8: e78886).
    1S
    Binding assays of recombinant hTLR4 aptamers
    In order to analyze the ability of each of the identified aptamers to join
    hTLR-4, experiments were performed in which hTLR4 was bound to a Ni-NTA resin
    previously balanced, through the histidine tag. Then the complexes
    twenty resin: protein containing 1 pmol of TLR4 were incubated with 1 pmol of the aptamers
    TLRApt # 1R (SEO ID NO: 3), TLRApt # 2F, TLRApt # 3R, and TLRApt # 4F (SEO ID NO: 4)
    previously structured by thermal denaturation at 9SoC for 10 min and
    subsequent renaturation at 4 ° C for 10 min. After incubating for 10 min at 3rC,
    the complexes were washed and the aptamers were recovered with 1S0 mM imidazole dissolved in
    2S PBS with 1 mM MgCb. Aptamer values bound to hTLR-4 were determined by
    Quantitative PCR (qPCR) using primers with the SEO ID NO: S and SEO ID sequences
    NO: 6 in a lOS thermal cycler (BioRad).
    Attachment assays of TLR-4 aptamers expressed in cells
    30 In order to analyze the ability of the identified aptamers to bind to the protein
    TLR-4 expressed in HEK-293 cells, 20 pmoles of each of the
    applaimers TLRApt # 1 R (SEO ID NO: 3), TLRApt # 2F, TLRApt # 3R, and TLRApt # 4F (SEO ID NO:
    4) on a culture of HEK-293-TLR4 cells seeded at 20,000 cells / well in plates
    96-well microtiter at a density of 2 x 104 cells / well, 2 days before the start
    3S of the essay. After incubating for 30 min at 3 ° C, S% CO2, the cells were washed,
    P201 430955
    The aptamers were recovered with 150 mM imidazole dissolved in PBS with 1 mM MgCl2, and qPCR was carried out to determine Cl values.
    Activity tests against the hTLR-4 receptor. To perform these tests, HEK-Blue hTLR4 cells (lnvivogen, ref. Hkbhtlr4) were used, which express the human TLR4 receptor, together with the MD2 and CD14 proteins, which are activated by the binding of their agonist, Escherichia coN lipopolysaccharide K12 (LPSEK). To detect the activation of TLR-4, this cell line contains a reporter gene SEAP (secreted embryonic alkaline phosphatase, in English "secreted embryonic alkaline phosphatase") which is controlled by the NF-kB promoter, so that it is expressed in response to this NF-kB signaling pathway, induced by TLR-4. The SEAP enzyme is secreted into the culture medium, and by adding and metabolizing its commercial substrate QUANTIBlue ™ (Invivogen, San Diego, California, USA) causes a color change of the medium from red to blue. On the other hand, the control agonist molecule LPS-EK UP (Iipopolysaccharide of E. coli K12 Ultra Puro) and the antagonist LPS-RS UP (Lipopolysaccharide of R. sphaeroides Ultra Puro) dissolve in 1mM MgCI2 in sterile PBS at concentrations of 0.02 ng / IJL and 2 ng /! JL, respectively. Aptamers are prepared at concentrations of 0.1, 1, 10 and 100 ng / IJL in 1 mM CI2 Mg in sterile PBS, denatured at 95c C for 10 min and structured at 4c C for 10 min.
    For the assay, HEK-Blue hTLR4 cells were seeded in 96-well microtiter plates at a density of 2 x 104 cells / well, 3 days before the start of the test in a total volume of 200 IJI of DMEM medium supplemented with 10% fetal bovine serum, 100 U / mi penicillin, 100 µg / ml streptomycin and 25 IJg / ml amphotericin. Next, 20 ~ I of the LPS-EK-UP control agonist (0.02 ng / IJI) was added. After 1 h of incubation at 37 ° C, 10 µJ / well of each concentration of aptamers (final concentrations of 0.2, 2, 20 and 200 nM or the control antagonist LPS-RS-UP (2 ng / ~ I; 20 ng) The activation of the hTLR4 receptor was measured 24 h later using 20 ~ I of the culture medium to which 1 00 ~ I of Quanty-Blue solution is added at room temperature.The color change of the medium is measured by absorbance at 630 nm
    Animal model of stroke Adult C57BL male mice weighing 28 to 30 g were used. C57BU10ScNJ (former name C57BU10ScCr), and C57BU10ScSn mice were purchased from The Jacksan Laboratory (Bar Harbar, Me, USA). Murine strain C57BU10ScNJ does not express functional TLR4 by deletion of the TLR4 gene, and strain C57BU10ScSn does not express any

    mutation in the TLR4 gene and is used as a control group. Four TLR4-deficient mice were used per group (C57BU10ScNJ) and 4 control mice per group (C57BL / 10ScSn). All experimental protocols were in accordance with the guidelines of the Animal Welfare Committee of the Complutense University (following European directives 86/609 / EEC and 32/2007 / EC). The animals have been housed in normal conditions of temperature, humidity and light / dark cycles of 12 hours with free access to food and
    Water.
    Induction of cerebral focal ischemia has been carried out by occlusion of the middle cerebral artery (in English ~ mediated cerebral occlusion ", MCAO) according to the teachings of Caso et al., 2007 (Caso et al., 2007, Circulation 115: 1599-608) Briefly, permanent focal cerebral ischemia is induced by ligation of the common carotid artery (ACC) and occlusion of the ipsilateral distal middle cerebral artery (ACM). Ventral-cervical incision starts to isolate said artery and permanently occlude it with ligature.For the MCL occlusion, an incision is made 1 cm from the perpendicular line that joins the lateral cantus of the left eye and the external auditory canal and is removed the temporal muscle A trepan is made to expose the ACM that is occluded by ligation After the surgery, the closure of the incisions and the disinfection, the animals are returned to their cages with free access of water and food. The constants of the animal are controlled.
    Brain damage was assessed by Magnetic Resonance imaging. Briefly, the mice were anesthetized with isoflurane and 24 hours after MCAO, the size of the infarction has been evaluated by MRI. The images highlighted in T2 (T2WI) have been acquired in a BIOSPEC BMT 47/40 operating at 4.7 T (Bruker-Medical, Ettlingen, Germany; MRI Unit, Pluridisciplinary Institute, UCM).
    EXAMPLE 1: Selection of specific aptamers against TLR-4
    The inventors used the RND40 aptamer library to carry out the selection of specific aptamers against TLR-4 supplied by IBA GmbH (Goettingen, Germany). The initial RND40 library consists of oligonucleotides (ssDNA) with fixed sequence at the ends, of 18 nucleotides each where the respective primers hybridize for PCR amplification, and a central region of 40 bases of random sequence.
    P201 430955
    The initial RND40 library of 1013 aptamers was enriched in specific aptamers against hTLR-4. As a preliminary step to the selection with TLR-4, a process of "counter-selection" of the library against the surface or matrix where the target molecule is presented (magnetic resin, cells of the same line as that expressed by the target protein) , etc.).
    EXAMPLE 2: Characterization of the selected aptamers
    Selected aptamers were identified after 6 rounds of selection following the following strategies: 10 a) By cloning the population of aptamers in a plasmid in order to obtain individual aptamers, and subsequent Sanger sequencing. b) By means of massive sequencing of the population of aptamers obtained, identifying aptamers that appear more repeated.
    The most represented sequences were chemically synthesized by IBA GmbH (Goettingen, Germany) and the affinity and activity of each of the aptamers were studied in recombinant protein hTLR-4 or HEK-293-TLR-4 cell binding assays, by ELONA, aptamer binding assays to the recombinant TLR-4 protein and TLR-4 expressed in cells, activity assays against the hTLR-4 receptor
    20 The results of the ELONA assays (Fig. 1) show that aptamers that more efficiently bind to recombinant hTLR-4 protein are TLRApt # 1R aptamers (SEO ID NO: 3) and TLRApt # 4F (SEO ID NO: 4). Using the same type of assay, the TLRApt # 2F and TLRApt # 3R aptamers were identified. Figure 2 shows
    25 show the most likely secondary sequences and structures of the TLRApt # 1R (SEO ID NO: 3) and TLRApt # 4F (SEO ID NO: 4) aptamers selected, obtained using mFold software (Zuker M., 2003, Nucleic Acids Res 31: 3406-15).
    The binding capacity of the aptamers to hTLR-4 was determined by incubation of the
    30 aptamers with a Ni-NTA resin with hTLR-4 bound, recovery and subsequent qPCR amplification of the bound aptamers. The results obtained show that all selected aptamers are capable of binding to the recombinant hTLR-4 protein (Fig. 3A). In these experiments, a lower et value indicates a greater amount of aptamer bound to hTLR-4.
    P201 430955
    In order to analyze the ability of the identified aptamers to bind to the TLR4 protein expressed in HEK-293 cells, 20 pmol (500 ng) of the TLRApt # 1 R aptamers (SEO ID NO: 3), TLRApt # 2F, TLRApt # 3R and TLRApt # 4F (SEO ID NO: 4) are added to a HEK-293-TLR4 cell culture. After incubating for 30 min, at 3rC, 5% CO2, the cells are washed, recovered and qPCR is made in order to calculate the Ct values. In these experiments, a lower Ct value indicates a greater amount of aptamer bound to the cells. The results obtained show that the selected aptamers TLRApt # 1 R (SEO ID NO: 3) and TLRApt # 4F (SEO ID NO: 4) (Fig. 38) are the ones that bind with the highest affinity.
    Subsequently, activity tests were performed against the hTLR-4 receptor to determine if the selected aptamers are capable of positively affecting (agonist activity) or negatively (antagonistic activity) the activity of the TLR-4 receptor. The results show that the TLRApt # 1 R aptamers (SEO ID NO: 3), TLRApt # 2F, TLRApt # 3R and TLRApt # 4F (SEO ID NO: 4) and have in vitro antagonistic activity (Fig. 4A).
    In view of these results, dose-response curves were performed in order to determine the concentration of each aptamer at which the maximum antagonistic effect is obtained. From the results obtained (Fig. 48) it can be concluded that the concentrations at which the best effect is observed are 20 nM for TLRApt # 1 R (SEO ID NO: 3) and 200 nM for TLRApt # 4F (SEO ID NO: 4). Statistical significance: ', P <0.05; ", P <0.01;" ', P <0.001.
    EXAMPLE 3: Optimization of TLR-4 antagonist aptamers to increase their activity and stability in animal models
    Aptamers that have shown the ability to inhibit the TLR-4 receptor have been modified by eliminating specific regions of their sequence, in order to increase their stability and / or resistance to nucleases. To this end, a study of the secondary structure of the different aptamers has been carried out using the mFold program (Zuker M., 2003, cited above) and the ability of aptamers to form G-quadruplex structures through the QGRS program has been analyzed. Mapper (Kikin et al., 2006, Nucleic Acids Res 34: W676-W682). In this way, the TLRApt # 1 R-T (SEO ID NO: 1) and TLRApt # 4F-T (SEO ID NO: 2) aptamers were designed and synthesized, corresponding to those identified in the first selections (Fig. 5).
    P201 430955
    EXAMPLE 4: Effect of TLR-4 antagonist aptamers in an animal model of stroke
    The ability of the new optimized aptamers to block the inflammatory response produced after a stroke episode in an animal stroke model was studied, evaluating the ability of the TLR-4 specific aptamers to reduce brain injury.
    For this, adult male mice deficient in TLR-4 (C57BU10ScNJ) and control mice expressing TLR-4 (C57BU10ScSn) were used, in which cerebral focal ischemia was induced by means of occlusion of the middle cerebral artery (MCAO). The results obtained in mice that normally express TLR4 (control mice) demonstrate that aptamers produce a decrease in size of the infarcted area which, in the case of TLRApt # 4F-T aptamer (SEQ ID NO: 2) is statistically significant. On the other hand, the results obtained in TLR-4 deficient mice show that there is no effect of
    15 TLRApt # 4F-T aptamer (SEO ID NO: 2) on which is obtained when mice are treated with the vehicle (Fig. 6). This data clearly indicates that the effect of the TLRApt # 4F-T aptamer (SEO ID NO: 2) occurs through TLR-4.
    Conclusions
    20 The TLRApt # lR (SEO ID NO: 3) and TLRApt # 4F (SEO ID NO: 4) aptamers have been selected against the extracellular domain of the TLR-4 receptor, which recognize the human TLR-4 receptor, both in form soluble recombinant (in vitro), as integrated into the membrane of HEK293 cells (in vivo). The TLRApt # lR (SEO ID NO: 3) and TLRApt # 4F (SEO ID NO: 4) aptamers show a
    25 antagonistic effect of the TLR-4 receptor. Truncated TLRApt # 1 RT aptamers (SEO ID NO: 1) and TLRApt # 4F-T (SEO ID NO: 2) that maintain the antagonistic activity of the original TLRApt # l R aptamers (SEO ID NO: 3) and TLRApt # 4F (SEO ID NO: 4), respectively. The TLRApt # 4F-T aptamer (SEO ID NO: 2) is able to reduce the infarcted area by
    30 animal model of stroke.
    P201 430955
    权利要求:
    Claims (14)
    [1]
    1. A nucleic acid aptamer capable of specifically binding and inhibiting
    TLR-4, and comprising a sequence selected from the group consisting of SEO 5 ID NO: 1 and SEQ ID NO: 2 or a functionally equivalent variant thereof.
    [2]
    2. Atamer according to claim 1, wherein the sequence is selected from the group consisting of SEO ID NO: 3 and SEO ID NO: 4.
    Aptomer according to any one of claims 10 2, wherein the nucleic acid is DNA.
    [4]
    Four. Atamer according to any one of claims 1 to 3, wherein the TLR-4 is a human TLR4.
    [5]
    5. A complex comprising the aptamer according to any one of claims 1 to 4 and a functional group.
    [6]
    6. A complex according to claim 5, wherein the functional group is a detectable reagent.
    [7]
    7. In vitro use of an aptamer according to any one of claims 1 to 4 or a complex according to any of claims 5 or 6 to detect TLR-4.
    Use according to claim 7, wherein the detection of TLR-4 is performed by a method selected from the group consisting of ELONA, aptacytochemistry, aptahistochemistry and flow cytometry.
    [9]
    9. In vitro use of an aptamer according to any one of claims 1 to 4 or a complex according to any of claims 5 or 6 to inhibit TLR-4.
    [10]
    10. In vitro method for the detection of TLR-4 in a sample comprising i) contacting said sample with an aptamer according to any one of claims 1 to 4, or a complex according to any of claims 5
    35 or 6, and ii) separate the aptamer or complex not bound to TLR-4,

    iii) detect the presence of the aptamer or complex bound to the TLR-4 present in the sample.
    [11]
    11. Method according to claim 10, wherein the detection is carried out by means of fluorescence.
    [12]
    12. In vitro method for inhibiting TLR-4 in a sample comprising contacting a sample comprising TLR-4 with an aptamer according to any of claims 1 to 4, or a complex according to any of claims 5 or 6, in
    10 suitable conditions inhibit TLR-4.
    [13]
    13. Method according to any of claims 10 to 12, wherein the sample is a biological sample of a subject.
    14. Method according to claim 13, wherein the subject is a human.
    [15]
    15. An aptamer according to claims 1 to 4 or a complex according to any of claims 5 or 6 for use in the manufacture of a medicament for the treatment of a pathology characterized by increased expression of TLR-4 and / or
    20 an increase in TLR-4 activation.
    [16]
    16. Atamer or complex for use according to claim 15, wherein the pathology characterized by an increase in expression and / or an increase in TLR-4 activation is stroke.
    [17]
    17. A pharmaceutical composition comprising at least one aptamer according to any one of claims 1 to 4 or at least one complex according to any of claims 5 or 6, optionally in combination with one or more pharmaceutically acceptable carriers, excipients or solvents.
    类似技术:
    公开号 | 公开日 | 专利标题
    US10808252B2|2020-10-20|Aptamers specific for TLR-4 and uses thereof
    US10760083B2|2020-09-01|DNA aptamer that binds to vWF
    Fernández et al.2018|TLR4-binding DNA aptamers show a protective effect against acute stroke in animal models
    US20210000981A1|2021-01-07|Conjugated polycationic polymers, methods of using the same and methods of treating autoimmune diseases, infectious diseases and acute radiation exposure
    Trujillo et al.2007|Development of the anti-VEGF aptamer to a therapeutic agent for clinical ophthalmology
    US20200181620A1|2020-06-11|Inhibitors of dek protein and related methods
    WO2013186857A1|2013-12-19|Aptamer to fgf2 and use thereof
    US10160973B2|2018-12-25|Nucleic acid aptamers binding to vascular endothelial growth factor receptors
    JP2021521806A|2021-08-30|TNF-directed aptamers and their use for treating or diagnosing TNF-related inflammatory diseases
    JPWO2017094897A1|2018-09-27|Anti-IL-17 aptamer with improved blood retention
    WO2011024955A1|2011-03-03|Nucleic acid capable of binding to tgf-βii-type receptor, and use thereof
    ES2351784T3|2011-02-10|MODULATORS OF PHARMACOLOGICAL AGENTS.
    WO2014169043A1|2014-10-16|Anti-inflammatory agents and methods of using the same
    同族专利:
    公开号 | 公开日
    PT3161139T|2020-10-23|
    US20170130227A1|2017-05-11|
    JP2017527260A|2017-09-21|
    RU2709718C9|2020-02-06|
    EP3161139A1|2017-05-03|
    CN106459980B|2020-11-03|
    JP6959738B2|2021-11-05|
    MX2016016992A|2017-05-03|
    PL3161139T3|2021-01-11|
    EP3161139B1|2020-07-22|
    WO2015197706A1|2015-12-30|
    ES2555160B1|2016-10-25|
    DK3161139T3|2020-10-19|
    AU2015279248B2|2021-03-11|
    CN106459980A|2017-02-22|
    RU2709718C2|2019-12-19|
    US10808252B2|2020-10-20|
    ES2825106T3|2021-05-14|
    JP2020127422A|2020-08-27|
    AU2015279248A1|2017-01-12|
    US20210130830A1|2021-05-06|
    RU2016152094A|2018-07-26|
    US10196642B2|2019-02-05|
    CN112111495A|2020-12-22|
    KR20170021298A|2017-02-27|
    CA2953020A1|2015-12-30|
    BR112016030172A2|2017-11-14|
    MA40283A|2017-05-03|
    SI3161139T1|2020-12-31|
    ZA201700363B|2018-11-28|
    US20190211334A1|2019-07-11|
    RU2016152094A3|2019-01-29|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    WO2006138681A2|2005-06-17|2006-12-28|University Of Rochester|Methods and compositions for enhancing immune memory by blocking intrahepatic activated t cell deletion|
    WO2012118911A1|2011-03-03|2012-09-07|Quark Pharmaceuticals, Inc.|Oligonucleotide modulators of the toll-like receptor pathway|
    US4522811A|1982-07-08|1985-06-11|Syntex Inc.|Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides|
    US5194599A|1988-09-23|1993-03-16|Gilead Sciences, Inc.|Hydrogen phosphonodithioate compositions|
    US5264562A|1989-10-24|1993-11-23|Gilead Sciences, Inc.|Oligonucleotide analogs with novel linkages|
    US5596086A|1990-09-20|1997-01-21|Gilead Sciences, Inc.|Modified internucleoside linkages having one nitrogen and two carbon atoms|
    AU784335B2|2000-02-03|2006-03-16|Research Development Foundation|Signaling aptamers that transduce molecular recognition to differential signal|
    FR2892730A1|2005-10-28|2007-05-04|Biomerieux Sa|Detecting the presence/risk of cancer development in a mammal, comprises detecting the presence/absence or quantity e.g. of nucleic acids and/or polypeptides coded by the nucleic acids, which indicates the presence/risk|
    US20090317802A1|2005-12-09|2009-12-24|Bhatia Sangeeta N|Compositions and Methods to Monitor RNA Delivery to Cells|
    US9012410B2|2006-12-13|2015-04-21|Case Western Reserve University|Method of treating intrauterine inflammation|
    KR20110081337A|2008-11-04|2011-07-13|이데라 파마슈티칼즈, 인코포레이티드|Modulation of toll-like receptor 4 expression by antisense oligonucleotides|
    WO2010060030A1|2008-11-24|2010-05-27|Arizona Board Of Regents, A Body Corporate Of The State Of Arizona|Tlr ligand-nucleic acid nanostructure as a novel immune modulatory agent and method of using the same|
    KR101937498B1|2011-03-03|2019-04-10|쿠아크 파마수티칼스 인코퍼레이티드|Compositions and methods for treating lung disease and injury|
    ES2555160B1|2014-06-24|2016-10-25|Aptus Biotech, S.L.|Specific aptamers of TLR-4 and their uses|EP3129462A1|2014-04-07|2017-02-15|INSERM - Institut National de la Santé et de la Recherche Médicale|New method for producing outer membrane vesicles|
    ES2555160B1|2014-06-24|2016-10-25|Aptus Biotech, S.L.|Specific aptamers of TLR-4 and their uses|
    AU2020276703A1|2019-05-16|2021-12-09|Aptatargets, S.L.|Treatment of TLR-4 mediated diseases and conditions with aptamers targeting TLR-4|
    WO2021257494A1|2020-06-15|2021-12-23|President And Fellows Of Harvard College|Methods for modulating tlr4 signaling|
    法律状态:
    2016-10-25| FG2A| Definitive protection|Ref document number: 2555160 Country of ref document: ES Kind code of ref document: B1 Effective date: 20161025 |
    2017-12-04| PC2A| Transfer of patent|Owner name: APTATARGETS, S.L. Effective date: 20171128 |
    优先权:
    申请号 | 申请日 | 专利标题
    ES201430955A|ES2555160B1|2014-06-24|2014-06-24|Specific aptamers of TLR-4 and their uses|ES201430955A| ES2555160B1|2014-06-24|2014-06-24|Specific aptamers of TLR-4 and their uses|
    RU2016152094A| RU2709718C9|2014-06-24|2015-06-24|Aptamers specific for tlr-4, and use thereof|
    KR1020177001493A| KR20170021298A|2014-06-24|2015-06-24|Aptamers specific for tlr-4 and uses thereof|
    CN202010953057.9A| CN112111495A|2014-06-24|2015-06-24|TLR-4 specific aptamer and application thereof|
    MA040283A| MA40283A|2014-06-24|2015-06-24|TLR-4 RECEIVER SPECIFIC APTAMERS AND THEIR USES|
    AU2015279248A| AU2015279248B2|2014-06-24|2015-06-24|Aptamers specific for TLR-4 and uses thereof|
    PL15732619T| PL3161139T3|2014-06-24|2015-06-24|Aptamers specific for tlr-4 and uses thereof|
    DK15732619.0T| DK3161139T3|2014-06-24|2015-06-24|TLR-4-SPECIFIC APPROACHES AND USES THEREOF|
    US15/322,021| US10196642B2|2014-06-24|2015-06-24|Aptamers specific for TLR-4 and uses thereof|
    CA2953020A| CA2953020A1|2014-06-24|2015-06-24|Aptamers specific for tlr-4 and uses thereof|
    CN201580034070.1A| CN106459980B|2014-06-24|2015-06-24|TLR-4 specific aptamer and application thereof|
    BR112016030172A| BR112016030172A2|2014-06-24|2015-06-24|specific aptamers for tlr-4 and their uses|
    PT157326190T| PT3161139T|2014-06-24|2015-06-24|Aptamers specific for tlr-4 and uses thereof|
    SI201531392T| SI3161139T1|2014-06-24|2015-06-24|Aptamers specific for tlr-4 and uses thereof|
    PCT/EP2015/064277| WO2015197706A1|2014-06-24|2015-06-24|Aptamers specific for tlr-4 and uses thereof|
    MX2016016992A| MX2016016992A|2014-06-24|2015-06-24|Aptamers specific for tlr-4 and uses thereof.|
    EP15732619.0A| EP3161139B1|2014-06-24|2015-06-24|Aptamers specific for tlr-4 and uses thereof|
    ES15732619T| ES2825106T3|2014-06-24|2015-06-24|Specific aptamers for TLR-4 and uses thereof|
    JP2016575345A| JP6959738B2|2014-06-24|2015-06-24|TLR-4 specific aptamers and their use|
    ZA2017/00363A| ZA201700363B|2014-06-24|2017-01-17|Aptamers specific for tlr-4 and uses thereof|
    US16/220,726| US10808252B2|2014-06-24|2018-12-14|Aptamers specific for TLR-4 and uses thereof|
    JP2020082070A| JP2020127422A|2014-06-24|2020-05-07|Aptamers specific for tlr-4 and uses thereof|
    US17/022,984| US20210130830A1|2014-06-24|2020-09-16|Aptamers specific for tlr-4 and uses thereof|
    [返回顶部]